Summary for ontology term: colonized germ free

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCTATTCCGCGTGTGGGATGACGGCCCTCGGGTTGTAAACCACTTTAGTAGAGAACGAAAAGGAGCTATCGAATAAATAGCTCTGCTGACGGTACTCTAAGAATAAGCACCGGC0.588235
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACGGCCCTACGGGTTGTAAACTTCTTTTGTCAGGGAGCAATTGGGTCCACGCGTGGGCTTGGCGAGAGTACCTGAAGAAAAAGCATCGGCTAAC0.545455
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGGGTGAAGAAGATCTTCGGATCGTAAAACCCTGTTGTTAGAGAAGAAAGTGCGTGAGAGTAACTGTTCACGTTTCGACGGTATCTAACCAGAAAGCCACGGC0.545455
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAATGTTCCACGTGTGGGATTTTGTATGTACCATATGAATAAGGATCGGCTAACT0.476190
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCTTACGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACTGCCCTATGGGTTGTAAACCTCTTTTGTCAGGGAGCAACGCCGGCTACGTGTAGCCGGACTGAGAGTACCTGAAGAAAAAGCATCGGCTAAC0.470588
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCAAGGGCAAGGCACGGTCTTTGGCCGTGTTGAGTGGATTGTTCGAATAAGCACCGGCTAACTAC0.470588
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGCCGGGGAGCAACGGGGTCCTTGCGAGGGCCCAATGAGAGTACCCGGAGAAAAAGCATCGGCTAAC0.470588
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGATGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.444444
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__DesulfovibrionaceaeTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGAAGGGAAGAAAGTGCGTGGTGCTAATCAGCCGCGTATTGACGGTACCTTCAAAGGAAGCACCGGC0.428571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAAAAGACGCCACGTGTGGCGTTCCGAGAGTACCCGAAGAAAAAGCATCGGCTAACT0.428571

Annotations:

common ontology terms
term enrichment score
TermScore
seattle0.666667
colonized germ free0.666667
cftr s489x0.500000
cystic fibrosis0.400000
LOWER IN cftr s489x0.250000
LOWER IN cystic fibrosis0.222222
mouse0.034483
mus musculus0.031250
research facility0.013514
control0.010695
LOWER IN control0.010471
united states of america0.008065
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN cftr s489x0.500000
seattle0.500000
colonized germ free0.500000
cftr s489x0.500000
LOWER IN cystic fibrosis0.333333
cystic fibrosis0.333333
mouse0.017544
mus musculus0.015873
research facility0.006803
control0.005405
LOWER IN control0.005405
united states of america0.004049
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
mus musculus1.000000
mouse1.000000
seattle1.000000
colonized germ free1.000000
control0.500000
cystic fibrosis0.500000
cftr s489x0.500000
LOWER IN cystic fibrosis0.166667
LOWER IN cftr s489x0.166667
LOWER IN control0.166667

Problems / suggestions? Please email info AT dbbact DOT org