Summary for ontology term: control

Number of annotations with term: 639

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.083551
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.073107
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.060052
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.060052
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTAGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.060052
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTCAACCGCGGGATTGCTTTTGGAACTGTCATGCTAGAGTGCAGGAGGGGTGAGCGGAATTCCTAG0.060052
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCCG0.060052
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.057441
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.057441
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.057441

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.158915
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.112403
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.093023
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.073643
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.073643
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.065891
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.065891
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.058140
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.058140
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.058140

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.151589
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.149893
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.146667
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.146497
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.145585
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.141243
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.138562
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.135279
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.135008
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG0.134700

Annotations:

common ontology terms
term enrichment score
TermScore
control0.746889
LOWER IN control0.572818
homo sapiens0.422265
feces0.374954
adult0.318425
research facility0.283262
united states of america0.271860
china0.220810
mus musculus0.191291
mouse0.176421
child0.150181
caecum0.106089
male0.098160
subgingival plaque0.086207
saliva0.085043
female0.080814
kingdom of spain0.077455
antibiotic0.077389
mouth0.073114
LOWER IN antibiotic0.068751
state of california0.067946
c57bl/60.065924
canada0.061635
human adult stage0.055944
periodontitis0.054299
dog0.053349
czech republic0.053333
rat0.052731
canis lupus familiaris0.052548
dentition0.051376
australia0.050269
nasopharynx0.048072
united kingdom0.046579
soil0.046326
LOWER IN periodontitis0.045662
LOWER IN ulcerative colitis0.045305
zhejiang province0.044843
guangzhou city prefecture0.042200
sprague dawley0.042126
sus scrofa0.041721
pig0.041721
horse0.041543
equus caballus0.041328
belgium0.041116
chicken0.040288
gallus gallus0.040126
LOWER IN crohn's disease0.039590
homosexual0.039562
msm0.039562
crohn's disease0.039519
ulcerative colitis0.039251
c57bl/6j0.038945
male organism0.037992
japan0.036932
tongue0.036199
mouth mucosa0.035874
farm0.035616
oral cavity0.035057
biopsy0.032738
obsolete_juvenile stage0.032560
LOWER IN hiv infection0.030757
rattus norvegicus0.030008
province of alberta0.029895
subgingival dental plaque0.029747
israel0.029718
skin0.029481
municipality of beijing0.029455
rhizosphere0.029286
age 6 weeks0.028612
rumen0.027688
hiv infection0.027682
italy0.027561
russia0.027322
dermal layer of tongue0.027211
kingdom of the netherlands0.027149
rectal swab0.026906
germany0.026178
atlanta0.024578
taiwan0.024427
adolescent stage0.024427
mus musculoides0.024427
nyulmc0.024427
nod/shiltj (no. 001976, jackson labs)0.024427
rattus0.024427
hong kong0.024427
nanjing city prefecture0.024427
age 2 months0.024133
ireland0.023988
vagina0.023657
supragingival plaque0.023472
commonwealth of pennsylvania0.023290
sweden0.023022
adult organism0.022504
brazil0.021769
LOWER IN colitis0.021594
diabetes mellitus0.021555
10-15-years-old human0.021555
obesity0.021325
amsterdam0.021325
ascending colon0.021212
Fraction of dbbact annotations with this term covered by the query
TermScore
control0.995025
LOWER IN control0.994898
LOWER IN hiv infection0.888889
LOWER IN disease0.833333
metronidazole0.833333
LOWER IN periodontitis0.833333
LOWER IN diarrhea0.800000
hiv infection0.800000
LOWER IN type 2 diabetes mellitus0.800000
antibiotic0.789474
LOWER IN antibiotic0.764706
LOWER IN ampicillin0.750000
periodontitis0.750000
stress0.750000
LOWER IN stress0.750000
probiotics0.750000
LOWER IN colitis0.750000
LOWER IN type i diabetes mellitus0.750000
type i diabetes mellitus0.750000
LOWER IN parkinson's disease0.750000
LOWER IN systemic lupus erythematosus0.750000
systemic lupus erythematosus0.750000
LOWER IN parasitic helminthiasis infectious disease0.750000
parasitic helminthiasis infectious disease0.750000
LOWER IN crohn's disease0.733333
LOWER IN metronidazole0.714286
colitis0.714286
homosexual0.714286
msm0.714286
crohn's disease0.687500
LOWER IN probiotics0.666667
autistic disorder0.666667
LOWER IN autistic disorder0.666667
LOWER IN sinusitis0.666667
LOWER IN pancreatic cancer0.666667
LOWER IN hymenolepis diminuta0.666667
hymenolepis diminuta0.666667
LOWER IN diabetes mellitus0.666667
diabetes mellitus0.666667
hangzhou city prefecture0.666667
chronic periodontitis0.666667
probiotic0.666667
LOWER IN drought environment0.666667
drought environment0.666667
atlanta0.666667
larvae0.666667
LOWER IN respiratory system disease0.666667
respiratory system disease0.666667
LOWER IN atopic dermatitis0.666667
LOWER IN plant disease0.666667
plant disease0.666667
salmonellosis0.666667
LOWER IN neomycin0.666667
streptomycin0.666667
mouth neoplasm0.666667
cancer0.666667
LOWER IN mouth neoplasm0.666667
LOWER IN cancer0.666667
LOWER IN polycystic ovary syndrome0.666667
10-15-years-old human0.666667
LOWER IN ulcerative colitis0.647059
ampicillin0.600000
nasopharynx0.600000
parkinson's disease0.600000
depth 5cm0.600000
guangzhou city prefecture0.571429
LOWER IN dental caries0.571429
dental caries0.571429
ulcerative colitis0.555556
sprague dawley0.545455
subgingival plaque0.526316
LOWER IN anorexia nervosa0.500000
anorexia nervosa0.500000
LOWER IN intensive care unit admission0.500000
LOWER IN critical illness0.500000
calgary0.500000
LOWER IN chronic gastritis0.500000
tongue0.500000
porites astreoides0.500000
bermuda0.500000
LOWER IN porites astreoides0.500000
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
LOWER IN low anterior resection0.500000
LOWER IN irritable bowel syndrome0.500000
irkutsk0.500000
adolescent stage0.500000
irritable bowel syndrome0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
chronic fatigue syndrome0.500000
LOWER IN short bowel syndrome0.500000
czech republic0.500000
short bowel syndrome0.500000
phoenix0.500000
children0.500000
dysplasia of cervix0.500000
LOWER IN dysplasia of cervix0.500000
LOWER IN acidosis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
control0.597809
homo sapiens0.555556
feces0.539906
LOWER IN control0.402191
adult0.338028
united states of america0.317684
research facility0.255086
china0.209703
mus musculus0.123631
mouse0.112676
child0.090767
caecum0.064163
male0.062598
female0.051643
saliva0.051643
subgingival plaque0.046948
kingdom of spain0.043818
antibiotic0.040689
mouth0.040689
state of california0.039124
canada0.035994
LOWER IN antibiotic0.035994
c57bl/60.035994
human adult stage0.031299
soil0.031299
canis lupus familiaris0.029734
dog0.029734
czech republic0.028169
periodontitis0.028169
dentition0.028169
rat0.028169
australia0.028169
nasopharynx0.025039
united kingdom0.025039
sus scrofa0.025039
pig0.025039
LOWER IN ulcerative colitis0.023474
LOWER IN periodontitis0.023474
zhejiang province0.023474
guangzhou city prefecture0.021909
belgium0.021909
sprague dawley0.021909
gallus gallus0.021909
chicken0.021909
equus caballus0.021909
horse0.021909
male organism0.021909
ulcerative colitis0.020344
japan0.020344
crohn's disease0.020344
LOWER IN crohn's disease0.020344
c57bl/6j0.020344
farm0.020344
homosexual0.020344
msm0.020344
tongue0.018779
mouth mucosa0.018779
oral cavity0.018779
biopsy0.017214
rhizosphere0.017214
obsolete_juvenile stage0.017214
skin0.017214
LOWER IN hiv infection0.015649
rumen0.015649
israel0.015649
italy0.015649
rattus norvegicus0.015649
subgingival dental plaque0.015649
germany0.015649
age 6 weeks0.015649
province of alberta0.015649
municipality of beijing0.015649
rectal swab0.014085
russia0.014085
hiv infection0.014085
dermal layer of tongue0.014085
kingdom of the netherlands0.014085
taiwan0.012520
adolescent stage0.012520
vagina0.012520
mus musculoides0.012520
nyulmc0.012520
nod/shiltj (no. 001976, jackson labs)0.012520
supragingival plaque0.012520
sweden0.012520
rattus0.012520
brazil0.012520
ireland0.012520
commonwealth of pennsylvania0.012520
hong kong0.012520
atlanta0.012520
adult organism0.012520
nanjing city prefecture0.012520
age 2 months0.012520
obesity0.010955
colon0.010955
leaf0.010955
intestine0.010955
diet0.010955
bos taurus0.010955
Number of experiments associating the term to the sequence
TermScore
control200.000000
LOWER IN control195.000000
feces110.000000
homo sapiens110.000000
united states of america67.000000
adult62.000000
research facility57.000000
china45.000000
mus musculus30.000000
mouse26.000000
child20.000000
caecum15.000000
antibiotic15.000000
female13.000000
LOWER IN antibiotic13.000000
saliva13.000000
periodontitis12.000000
LOWER IN ulcerative colitis11.000000
crohn's disease11.000000
LOWER IN crohn's disease11.000000
ulcerative colitis10.000000
subgingival plaque10.000000
LOWER IN periodontitis10.000000
male10.000000
soil9.000000
c57bl/69.000000
mouth9.000000
state of california8.000000
LOWER IN hiv infection8.000000
hiv infection8.000000
kingdom of spain8.000000
dentition7.000000
rat7.000000
australia7.000000
canis lupus familiaris7.000000
dog7.000000
canada6.000000
obesity6.000000
farm6.000000
nasopharynx6.000000
LOWER IN colitis6.000000
sprague dawley6.000000
LOWER IN disease5.000000
human adult stage5.000000
russia5.000000
LOWER IN metronidazole5.000000
c57bl/6j5.000000
metronidazole5.000000
rhizosphere5.000000
colitis5.000000
israel5.000000
homosexual5.000000
msm5.000000
zhejiang province5.000000
oral cavity5.000000
gallus gallus5.000000
chicken5.000000
united kingdom5.000000
tongue4.000000
japan4.000000
guangzhou city prefecture4.000000
czech republic4.000000
LOWER IN diarrhea4.000000
intestine4.000000
bos taurus4.000000
LOWER IN type 2 diabetes mellitus4.000000
mouth mucosa4.000000
rattus norvegicus4.000000
equus caballus4.000000
horse4.000000
skin4.000000
LOWER IN dental caries4.000000
dental caries4.000000
rectal swab3.000000
LOWER IN irritable bowel syndrome3.000000
adolescent stage3.000000
irritable bowel syndrome3.000000
vagina3.000000
biopsy3.000000
rumen3.000000
LOWER IN ampicillin3.000000
ampicillin3.000000
stress3.000000
LOWER IN stress3.000000
probiotics3.000000
diet3.000000
supragingival plaque3.000000
italy3.000000
belgium3.000000
rattus3.000000
LOWER IN type i diabetes mellitus3.000000
type i diabetes mellitus3.000000
parkinson's disease3.000000
LOWER IN parkinson's disease3.000000
obsolete_juvenile stage3.000000
LOWER IN systemic lupus erythematosus3.000000
systemic lupus erythematosus3.000000
subgingival dental plaque3.000000
depth 5cm3.000000
kingdom of the netherlands3.000000
LOWER IN parasitic helminthiasis infectious disease3.000000
parasitic helminthiasis infectious disease3.000000
taiwan2.000000
colon2.000000
leaf2.000000
LOWER IN probiotics2.000000
autistic disorder2.000000
LOWER IN autistic disorder2.000000
LOWER IN sinusitis2.000000
dermal layer of tongue2.000000
LOWER IN pancreatic cancer2.000000
sweden2.000000
LOWER IN hymenolepis diminuta2.000000
hymenolepis diminuta2.000000
LOWER IN diabetes mellitus2.000000
diabetes mellitus2.000000
hangzhou city prefecture2.000000
brazil2.000000
chronic periodontitis2.000000
probiotic2.000000
germany2.000000
ireland2.000000
LOWER IN drought environment2.000000
drought environment2.000000
commonwealth of pennsylvania2.000000
hong kong2.000000
atlanta2.000000
larvae2.000000
amsterdam2.000000
LOWER IN respiratory system disease2.000000
respiratory system disease2.000000
LOWER IN atopic dermatitis2.000000
LOWER IN plant disease2.000000
plant disease2.000000
adult organism2.000000
salmonellosis2.000000
LOWER IN neomycin2.000000
nanjing city prefecture2.000000
sus scrofa2.000000
pig2.000000
male organism2.000000
age 2 months2.000000
streptomycin2.000000
mouth neoplasm2.000000
cancer2.000000
LOWER IN mouth neoplasm2.000000
LOWER IN cancer2.000000
LOWER IN polycystic ovary syndrome2.000000
10-15-years-old human2.000000
LOWER IN anorexia nervosa1.000000
anorexia nervosa1.000000
LOWER IN intensive care unit admission1.000000
LOWER IN critical illness1.000000
calgary1.000000
LOWER IN chronic gastritis1.000000
porites astreoides1.000000
bermuda1.000000
LOWER IN porites astreoides1.000000
low anterior resection1.000000
taipei city1.000000
LOWER IN low anterior resection1.000000
irkutsk1.000000
LOWER IN chronic fatigue syndrome1.000000
new york county1.000000
chronic fatigue syndrome1.000000
LOWER IN short bowel syndrome1.000000
short bowel syndrome1.000000
phoenix1.000000
children1.000000
dysplasia of cervix1.000000
LOWER IN dysplasia of cervix1.000000
LOWER IN acidosis1.000000
mus musculoides1.000000
nyulmc1.000000
nod/shiltj (no. 001976, jackson labs)1.000000
age 6 weeks1.000000
ascending colon1.000000
province of alberta1.000000
municipality of beijing1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
37amnonhigh in tomato plant leaves compared to plastic control ( high in solanum lycopersicum compared to control in leaf maryland county )2016-12-09v41 / 1approvedNo
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v31 / 1approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v41 / 1approvedNo
384amnon high in asthma compared to control in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v41 / 1approvedNo
607amnon high in control compared to parkinson's disease in homo sapiens nasopharynx germany nasal wash 2020-04-19v41 / 1approvedNo
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v41 / 1approvedNo
857amnon high in bacillus thuringiensis toxin producing cotton compared to control in agricultural feature state of north carolina whole body larvae third instar larva stage helicoverpa zea bollworm cotton field 2022-01-10v31 / 1approvedNo
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in estradiol bisphenol a compared to control in research facility intestine danio rerio zebra fish china )2017-04-09v41 / 1approvedNo
114amnon high in control compared to contaminated water polychlorinated biphenyl 126 pcb in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v41 / 1approvedNo
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in neutrophil hirschsprung disease high neutrophils compared to control low neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v41 / 1approvedNo
117amnonlower in sox10 mutant fish with high neutrophil count ( high in control low neutrophils compared to neutrophil hirschsprung disease high neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v41 / 1approvedNo
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in feces caecum mus musculus c57bl/6j mouse )2017-04-14v41 / 1approvedNo
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v41 / 1approvedNo
144amnon high in ancylostoma compared to control in feces canis lupus familiaris australia dog 2017-04-19v41 / 1approvedNo
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v41 / 1approvedNo
680amnon high in probiotic bifidobacterium longum probiotic compared to control in feces homo sapiens obesity adult russia novosibirsk 2028-03-04v31 / 1approvedNo
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in feces homo sapiens pathogen israel )2017-10-05v41 / 1approvedNo
702amnon high in control compared to clostridium difficile infection in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v41 / 1approvedNo
736amnon high in control compared to parasitic helminthiasis infectious disease helminthiasis in feces homo sapiens female adult tanzania pemba island 2021-01-25v31 / 1approvedNo
1010amnon high in abnormality of the intestine chronic enteropathy canine chronic enteropathy compared to control in feces united states of america canis lupus familiaris commonwealth of pennsylvania dog 2023-02-02v41 / 1approvedNo
9amnonmuch higher when coral is present ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v41 / 2approvedNo
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v41 / 2approvedNo
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v41 / 2approvedNo
344amnon high in control compared to hiv infection in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v41 / 2approvedNo
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v31 / 2approvedNo
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v31 / 2approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v41 / 2approvedNo
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v41 / 2approvedNo
604amnon high in bronchitis infectious bronchitis virus compared to control in research facility caecum gallus gallus chicken cecal content china 2020-04-06v31 / 2approvedNo
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v41 / 2approvedNo
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v31 / 2approvedNo
102amnon high in hiv infection compared to control in homo sapiens united states of america cheek atlanta mouth 2017-04-04v41 / 2approvedNo
114amnon high in contaminated water polychlorinated biphenyl 126 pcb compared to control in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v41 / 2approvedNo
123amnon high in olanzapine compared to control in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v41 / 2approvedNo
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in feces homo sapiens child africa )2018-12-08v41 / 2approvedNo
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v41 / 2approvedNo
694amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female obesity adult china shanghai district 2028-03-17v31 / 2approvedNo
227amnonlower in infants with respiratory illness compared to healthy controls ( high in control compared to respiratory system disease in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v41 / 2approvedNo
239amnon high in control compared to carcinoma colorectal adenocarcinoma colorectal cancer in feces homo sapiens united states of america 2017-11-08v41 / 2approvedNo
963amnon high in virginiamycin compared to control in united states of america research facility caecum gallus gallus chicken broiler chicken male organism state of indiana age 5 weeks 2022-12-21v41 / 2approvedNo
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v31 / 2approvedNo
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in feces canis lupus familiaris italy dog )2019-02-25v41 / 2approvedNo
985amnon high in control compared to gingival bleeding in homo sapiens saliva adult hong kong oral rinse 2022-12-26v11 / 2approvedNo
1003amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens india hyderabad 2022-12-31v31 / 2approvedNo
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in feces homo sapiens adult taipei city taiwan )2019-07-18v31 / 3approvedNo
16amnon high in diarrhea compared to control in feces felis catus state of california 2016-11-08v41 / 3approvedNo
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v41 / 3approvedNo
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v41 / 3approvedNo
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 3approvedNo
803amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens united states of america adult commonwealth of massachusetts caribbean latino human late adulthood stage 2021-06-18v41 / 3approvedNo
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v41 / 3approvedNo
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v41 / 3approvedNo
607amnon high in rem sleep behavior disorder parkinson's disease compared to control in feces homo sapiens germany 2020-04-19v41 / 3approvedNo
104amnon high in control compared to periodontitis in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v41 / 3approvedNo
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v41 / 3approvedNo
902amnondominant feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v41 / 3approvedNo
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v41 / 3approvedNo
966amnon high in malnutrition protein-energy malnutrition severe malnutririon compared to control in feces homo sapiens infant rural community gambia 1-year-old human stage 2022-12-21v31 / 3approvedNo
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v41 / 3approvedNo
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v31 / 3approvedNo
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v41 / 3approvedNo
988amnon high in control compared to mouthwash in homo sapiens tonsil male australia homosexual msm young adult stage tonsil surface 2022-12-26v41 / 3approvedNo
1000amnon high in obesity obese body mass index status type 2 diabetes mellitus compared to control in feces homo sapiens female adult viet nam 2022-12-31v31 / 3approvedNo
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v41 / 4approvedNo
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in nasopharynx bos taurus canada cow )2018-04-30v41 / 4approvedNo
555amnon high in autistic disorder autism compared to control in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v31 / 4approvedNo
570amnon high in visceral leishmaniasis compared to control in feces homo sapiens india bihar state 2019-12-16v31 / 4approvedNo
597amnon high in gout compared to control in feces homo sapiens adult zhejiang province china 2020-03-23v31 / 4approvedNo
597amnon high in control compared to gout in feces homo sapiens adult zhejiang province china 2020-03-23v31 / 4approvedNo
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in feces homo sapiens germany 2020-04-19v41 / 4approvedNo
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v41 / 4approvedNo
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v41 / 4approvedNo
685amnon high in control compared to helicobacter pylori infectious disease in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v31 / 4approvedNo
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in feces united states of america mus musculus balb/c state of texas mouse )2017-10-06v41 / 4approvedNo
716amnon high in halitosis chronic bad breath compared to control in homo sapiens tongue adult dermal layer of tongue china 2028-05-22v31 / 4approvedNo
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 5approvedNo
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v41 / 5approvedNo
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v41 / 5approvedNo
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens city infant vellore district india 2-month-old human stage )2018-05-14v41 / 5approvedNo
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v41 / 5approvedNo
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v31 / 5approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v41 / 5approvedNo
831amnon high in control compared to pancreatic cancer in feces homo sapiens adult israel 2021-09-11v31 / 5approvedNo
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v31 / 5approvedNo
607amnon high in parkinson's disease compared to control in homo sapiens nasopharynx germany nasal wash 2020-04-19v41 / 5approvedNo
96amnon high in control compared to systemic lupus erythematosus in homo sapiens brazil subgingival plaque mouth 2017-03-29v41 / 5approvedNo
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 5approvedNo
104amnon high in periodontitis compared to control in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v41 / 5approvedNo
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 5approvedNo
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 5approvedNo
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 5approvedNo
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to atopic dermatitis allergy in united states of america skin felis catus cat )2017-07-05v41 / 5approvedNo
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v41 / 5approvedNo
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v41 / 5approvedNo
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v41 / 5approvedNo
448amnonhigh freq. in healthy horse feces (dominant feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v41 / 5approvedNo
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in feces homo sapiens united states of america )2017-10-23v41 / 5approvedNo
954amnon high in salmonella infections compared to control in united states of america research facility caecum antibiotic mus musculus c57bl/6 state of florida mouse streptomycin female organism 2022-12-15v41 / 5approvedNo
954amnon high in control compared to salmonella infections in united states of america research facility caecum antibiotic mus musculus c57bl/6 state of florida mouse streptomycin female organism 2022-12-15v41 / 5approvedNo
963amnon high in avilamycin compared to control in united states of america research facility caecum gallus gallus chicken broiler chicken male organism state of indiana age 5 weeks 2022-12-21v41 / 5approvedNo
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v31 / 5approvedNo
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v41 / 6approvedNo
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v31 / 6approvedNo
384amnon high in control compared to asthma in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v41 / 6approvedNo
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v31 / 6approvedNo
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v41 / 6approvedNo
698amnondominant control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v31 / 6approvedNo
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v31 / 6approvedNo
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v41 / 6approvedNo
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v41 / 6approvedNo
239amnon high in carcinoma colorectal adenocarcinoma colorectal cancer compared to control in feces homo sapiens united states of america 2017-11-08v41 / 6approvedNo
966amnon high in control compared to malnutrition protein-energy malnutrition severe malnutririon in feces homo sapiens infant rural community gambia 1-year-old human stage 2022-12-21v31 / 6approvedNo
968amnon high in control compared to atopic dermatitis in homo sapiens skin adult switzerland elbow zurich antecubital fossa 2022-12-23v11 / 6approvedNo
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v41 / 6approvedNo
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v31 / 6approvedNo
985amnon high in dentures compared to control in homo sapiens saliva adult hong kong oral rinse 2022-12-26v11 / 6approvedNo
985amnon high in gingival bleeding compared to control in homo sapiens saliva adult hong kong oral rinse 2022-12-26v11 / 6approvedNo
1000amnon high in control compared to obesity obese body mass index status type 2 diabetes mellitus in feces homo sapiens female adult viet nam 2022-12-31v31 / 6approvedNo
973amnon high in control compared to footrot disease in farm research facility interdigital region skin ovis aries sheep pes united kingdom coventry 2023-01-26v11 / 6approvedNo
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v41 / 6approvedNo
1021amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens obesity obese body mass index status russia irkutsk adolescent stage 2023-04-06v31 / 7approvedNo
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v41 / 7approvedNo
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v31 / 7approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v41 / 7approvedNo
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v31 / 7approvedNo
378amnon high in periodontitis compared to control in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v41 / 7approvedNo
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v41 / 7approvedNo
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v41 / 7approvedNo
685amnon high in helicobacter pylori infectious disease compared to control in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v31 / 7approvedNo
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v41 / 7approvedNo
963amnon high in control compared to virginiamycin in united states of america research facility caecum gallus gallus chicken broiler chicken male organism state of indiana age 5 weeks 2022-12-21v41 / 7approvedNo
968amnon high in control compared to atopic dermatitis in homo sapiens skin adult switzerland neck zurich 2022-12-23v11 / 7approvedNo
730amnon high in crohn's disease compared to control in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v11 / 7approvedNo
985amnon high in control compared to dentures in homo sapiens saliva adult hong kong oral rinse 2022-12-26v11 / 7approvedNo
37amnonhigh in tomato plant leaves compared to plastic controls ( high in solanum lycopersicum compared to control in leaf maryland county )2016-12-09v41 / 8approvedNo
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v31 / 8approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v41 / 8approvedNo
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v41 / 8approvedNo
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 8approvedNo
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v41 / 8approvedNo
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v41 / 8approvedNo
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v31 / 8approvedNo
535amnon high in dysplasia of cervix compared to control in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v41 / 9approvedNo
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v41 / 9approvedNo
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v41 / 9approvedNo
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v41 / 9approvedNo
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v31 / 9approvedNo
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam homosexual msm 2020-05-31v41 / 9approvedNo
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 9approvedNo
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v41 / 9approvedNo
678amnon high in tooth disease black dental staining compared to control in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v31 / 9approvedNo
693amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female adult austria graz city district 2028-03-16v11 / 9approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens child tanzania age 1-3 years pemba island 2-year-old human stage 1-year-old human stage 2021-01-25v31 / 9approvedNo
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v41 / 9approvedNo
1003amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens india hyderabad 2022-12-31v31 / 9approvedNo
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v41 / 10approvedNo
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 10approvedNo
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v31 / 10approvedNo
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v31 / 10approvedNo
378amnon high in control compared to periodontitis in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v41 / 10approvedNo
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v31 / 10approvedNo
857amnon high in control compared to bacillus thuringiensis toxin producing cotton in agricultural feature state of north carolina whole body larvae third instar larva stage helicoverpa zea bollworm cotton field 2022-01-10v31 / 10approvedNo
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v41 / 10approvedNo
700amnon high in caecum compared to colon in control research facility sus scrofa belgium pig age 2 months 2028-04-01v31 / 10approvedNo
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v31 / 10approvedNo
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v31 / 10approvedNo
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v41 / 10approvedNo
2amnon high in control compared to anorexia nervosa in feces homo sapiens 2016-10-05v41 / 11approvedNo
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v41 / 11approvedNo
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v41 / 11approvedNo
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v31 / 11approvedNo
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to braces teeth braces in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v31 / 11approvedNo
96amnon high in systemic lupus erythematosus compared to control in homo sapiens brazil subgingival plaque mouth 2017-03-29v41 / 11approvedNo
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v31 / 11approvedNo
787amnondominant control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v31 / 11approvedNo
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in united states of america soil state of california depth 5cm )2017-07-25v41 / 11approvedNo
202amnon high in neoplasm mouth neoplasm cancer compared to control in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v41 / 11approvedNo
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v41 / 12approvedNo
796amnon high in control compared to graves' disease in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v31 / 12approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v41 / 12approvedNo
1020amnon high in remission ulcerative colitis compared to control in feces homo sapiens adult japan human adult stage 2023-04-06v31 / 13approvedNo
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v31 / 13approvedNo
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v31 / 13approvedNo
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v31 / 13approvedNo
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v41 / 13approvedNo
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v41 / 13approvedNo
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v41 / 13approvedNo
232amnonhigher in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in ulcer wound compared to control in homo sapiens skin foot australia diabetes mellitus )2017-11-05v41 / 13approvedNo
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v31 / 13approvedNo
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v41 / 13approvedNo
1010amnon high in control compared to abnormality of the intestine chronic enteropathy canine chronic enteropathy in feces united states of america canis lupus familiaris commonwealth of pennsylvania dog 2023-02-02v41 / 13approvedNo
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus balb/c japan )2016-12-10v41 / 14approvedNo
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v31 / 14approvedNo
576amnon high in aphthous stomatitis compared to control in homo sapiens adult czech republic mouth 2020-01-09v31 / 14approvedNo
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v31 / 14approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v41 / 14approvedNo
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v41 / 14approvedNo
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v41 / 14approvedNo
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v41 / 14approvedNo
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v41 / 14approvedNo
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 15approvedNo
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v41 / 15approvedNo
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v41 / 15approvedNo
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v41 / 15approvedNo
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v41 / 15approvedNo
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v41 / 15approvedNo
102amnon high in control compared to hiv infection in homo sapiens united states of america cheek atlanta mouth 2017-04-04v41 / 15approvedNo
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v41 / 15approvedNo
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 15approvedNo
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v41 / 15approvedNo
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v31 / 15approvedNo
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v41 / 15approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens female adult tanzania pemba island 2021-01-25v31 / 15approvedNo
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v11 / 16approvedNo
535amnon high in control compared to dysplasia of cervix in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v41 / 16approvedNo
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 16approvedNo
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v41 / 16approvedNo
576amnon high in aphthous stomatitis compared to control in homo sapiens tongue adult czech republic 2020-01-09v31 / 16approvedNo
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v31 / 16approvedNo
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v31 / 16approvedNo
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v41 / 16approvedNo
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v41 / 16approvedNo
162amnon high in control compared to periodontitis in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v41 / 16approvedNo
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v31 / 16approvedNo
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v41 / 16approvedNo
978amnon high in control compared to inflammatory bowel disease inflammatory bowel disease in research facility monkey captive callithrix jacchus marmosets rectal swab 2022-12-24v41 / 16approvedNo
980amnon high in control compared to mental depression in feces homo sapiens china hangzhou city prefecture 2022-12-25v31 / 16approvedNo
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v31 / 16approvedNo
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v41 / 17approvedNo
570amnon high in control compared to visceral leishmaniasis in feces homo sapiens india bihar state 2019-12-16v31 / 17approvedNo
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v31 / 17approvedNo
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v41 / 17approvedNo
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v41 / 17approvedNo
607amnondominant feces, homo sapiens, control, germany2020-04-19v41 / 17approvedNo
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v41 / 17approvedNo
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v41 / 17approvedNo
212amnondominant feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v41 / 17approvedNo
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v41 / 17approvedNo
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v11 / 17approvedNo
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in feces research facility mus musculus balb/c mouse japan )2019-03-12v41 / 17approvedNo
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v41 / 17approvedNo
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v31 / 17approvedNo
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v41 / 18approvedNo
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v41 / 18approvedNo
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v31 / 18approvedNo
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens nasopharynx adult belgium 2019-12-05v41 / 18approvedNo
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v41 / 18approvedNo
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v31 / 18approvedNo
84amnonincreases in drought in late time points ( high in timepoint drought environment compared to control in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v41 / 18approvedNo
102amnon high in control compared to hiv infection in homo sapiens united states of america dentition atlanta mouth 2017-04-04v41 / 18approvedNo
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in feces homo sapiens child africa )2018-12-08v41 / 18approvedNo
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v41 / 18approvedNo
944amnondominant control, adult, biopsy, ireland, large intestine2022-11-26v31 / 18approvedNo
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v41 / 18approvedNo
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v31 / 18approvedNo
555amnon high in control compared to autistic disorder autism in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v31 / 19approvedNo
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v31 / 19approvedNo
866amnondominant feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v41 / 19approvedNo
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 19approvedNo
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v31 / 19approvedNo
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin foot australia )2017-11-05v41 / 19approvedNo
959amnondominant feces, homo sapiens, control, united states of america, child, state of california, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 19approvedNo
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v31 / 19approvedNo
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v41 / 19approvedNo
2amnon high in anorexia nervosa compared to control in feces homo sapiens 2016-10-05v41 / 20approvedNo
46amnonsmj: higher in mice feces with antiobiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 20approvedNo
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v41 / 20approvedNo
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v41 / 20approvedNo
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v41 / 20approvedNo
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v41 / 20approvedNo
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 20approvedNo
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v41 / 20approvedNo
704amnon high in periodontitis compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v31 / 20approvedNo
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in research facility larval stage body proper ixodes scapularis tick )2017-12-10v41 / 20approvedNo
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v41 / 20approvedNo
1020amnondominant feces, homo sapiens, control, adult, japan, human adult stage2023-04-06v31 / 21approvedNo
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth adult czech republic 2020-01-09v31 / 21approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v41 / 21approvedNo
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v31 / 21approvedNo
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v31 / 21approvedNo
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v41 / 21approvedNo
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v41 / 21approvedNo
911amnon high in spinal cord injury compared to control in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v41 / 21approvedNo
911amnondominant feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v41 / 21approvedNo
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v31 / 21approvedNo
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v31 / 21approvedNo
978amnon high in inflammatory bowel disease inflammatory bowel disease compared to control in research facility monkey captive callithrix jacchus marmosets rectal swab 2022-12-24v41 / 21approvedNo
1017amnondominant homo sapiens, control, adult, canada, calgary, rectal swab, human adult stage2023-04-02v41 / 22approvedNo
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v41 / 22approvedNo
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v41 / 22approvedNo
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v41 / 22approvedNo
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v31 / 22approvedNo
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v31 / 22approvedNo
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v41 / 22approvedNo
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens united states of america female pregnancy vagina )2017-09-05v41 / 22approvedNo
924amnon high in control compared to dental caries dental caries in child guangzhou city prefecture supragingival plaque supragingival dental plaque china 7-year-old human stage 8-year-old human stage 2022-07-27v31 / 22approvedNo
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v31 / 22approvedNo
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v41 / 22approvedNo
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v41 / 22approvedNo
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v41 / 22approvedNo
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v41 / 22approvedNo
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v41 / 22approvedNo
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v41 / 23approvedNo
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v31 / 23approvedNo
576amnon high in control compared to aphthous stomatitis in homo sapiens tongue adult czech republic 2020-01-09v31 / 23approvedNo
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v41 / 23approvedNo
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v31 / 23approvedNo
963amnon high in control compared to avilamycin in united states of america research facility caecum gallus gallus chicken broiler chicken male organism state of indiana age 5 weeks 2022-12-21v41 / 23approvedNo
1010amnondominant feces, control, united states of america, canis lupus familiaris, commonwealth of pennsylvania, dog2023-02-02v41 / 23approvedNo
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v41 / 24approvedNo
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v41 / 24approvedNo
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v41 / 24approvedNo
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v31 / 24approvedNo
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v31 / 25approvedNo
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v31 / 25approvedNo
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v41 / 25approvedNo
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v41 / 25approvedNo
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v41 / 25approvedNo
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v31 / 25approvedNo
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 26approvedNo
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v31 / 26approvedNo
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v31 / 26approvedNo
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v41 / 26approvedNo
1000amnondominant feces, homo sapiens, control, female, adult, viet nam2022-12-31v31 / 26approvedNo
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v31 / 27approvedNo
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v31 / 27approvedNo
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v41 / 27approvedNo
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v31 / 27approvedNo
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v41 / 27approvedNo
924amnon high in dental caries dental caries compared to control in child guangzhou city prefecture supragingival plaque supragingival dental plaque china 7-year-old human stage 8-year-old human stage 2022-07-27v31 / 27approvedNo
959amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america child state of california los angeles 6-12 year-old child stage adolescent stage 2022-12-19v41 / 27approvedNo
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v41 / 27approvedNo
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 28approvedNo
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 28approvedNo
154amnonstrongly correlated with high uranium concentration ( high in uranium high urnaium compared to control in sediment soil australia kakadu national park )2017-06-29v41 / 28approvedNo
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v41 / 29approvedNo
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v41 / 29approvedNo
693amnon high in polycystic ovary syndrome compared to control in feces homo sapiens female adult austria graz city district 2028-03-16v11 / 29approvedNo
704amnon high in control compared to dental caries in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v31 / 29approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in feces research facility mus musculus balb/c mouse japan )2019-03-12v41 / 29approvedNo
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v41 / 30approvedNo
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v41 / 30approvedNo
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v41 / 30approvedNo
774amnon high in tonsillitis compared to control in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v31 / 30approvedNo
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v41 / 30approvedNo
988amnon high in mouthwash compared to control in homo sapiens tonsil male australia homosexual msm young adult stage tonsil surface 2022-12-26v41 / 30approvedNo
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v31 / 31approvedNo
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v41 / 31approvedNo
652amnon high in control compared to rheumatoid arthritis in homo sapiens saliva adult sichuan province china 2020-09-13v31 / 31approvedNo
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in feces united states of america felis catus state of colorado cat )2018-12-25v41 / 31approvedNo
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v41 / 31approvedNo
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v41 / 31approvedNo
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v41 / 31approvedNo
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v31 / 32approvedNo
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v41 / 32approvedNo
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v41 / 33approvedNo
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v41 / 33approvedNo
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v41 / 34approvedNo
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v41 / 34approvedNo
127amnonhigher in vaccinated chickens ( high in vaccination salmune vaccination compared to control in united states of america caecum gallus gallus chicken )2017-04-14v41 / 34approvedNo
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v41 / 34approvedNo
1017amnon high in control compared to disease intensive care unit admission critical illness in homo sapiens adult canada calgary rectal swab human adult stage 2023-04-02v41 / 35approvedNo
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v41 / 35approvedNo
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v31 / 35approvedNo
955amnon high in control compared to periodontitis periodontitis in canis lupus familiaris chile subgingival plaque dog adult organism subgingival dental plaque 2022-12-17v41 / 35approvedNo
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v41 / 35approvedNo
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v41 / 35approvedNo
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v41 / 36approvedNo
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v41 / 36approvedNo
196amnonhigher in heated tap water 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water drinking water )2017-09-12v41 / 36approvedNo
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v41 / 36approvedNo
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v41 / 37approvedNo
84amnondisappears in drought in late time points ( high in control compared to timepoint drought environment in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v41 / 37approvedNo
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v41 / 37approvedNo
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in feces united states of america research facility mus musculus mouse cba/j mice )2017-08-24v41 / 37approvedNo
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v41 / 37approvedNo
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v41 / 37approvedNo
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v31 / 38approvedNo
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica oleracea brassica china )2017-07-27v41 / 38approvedNo
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v41 / 38approvedNo
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v41 / 38approvedNo
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v41 / 38approvedNo
51amnon high in hiv infection compared to control in feces homo sapiens united states of america 2017-01-19v41 / 39approvedNo
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v41 / 39approvedNo
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v31 / 39approvedNo
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v31 / 39approvedNo
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v31 / 39approvedNo
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v31 / 40approvedNo
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 40approvedNo
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v41 / 40approvedNo
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v31 / 40approvedNo
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in digestive system research facility oreochromis niloticus fish china )2017-12-24v41 / 40approvedNo
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v41 / 41approvedNo
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v41 / 41approvedNo
555amnon high in control compared to autistic disorder autism in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v31 / 43approvedNo
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v31 / 43approvedNo
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v41 / 44approvedNo
866amnon high in stress restraint stress compared to control in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v41 / 44approvedNo
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v31 / 44approvedNo
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v41 / 44approvedNo
725amnon high in periodontitis chronic periodontitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v31 / 44approvedNo
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v41 / 45approvedNo
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v41 / 45approvedNo
1020amnoncommon feces, homo sapiens, control, adult, japan, human adult stage2023-04-06v31 / 46approvedNo
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v31 / 46approvedNo
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 46approvedNo
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in united states of america soil state of california depth 5cm )2017-07-25v41 / 46approvedNo
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v41 / 46approvedNo
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v41 / 47approvedNo
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v31 / 47approvedNo
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v41 / 47approvedNo
96amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque mouth 2017-03-29v41 / 48approvedNo
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v31 / 48approvedNo
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v41 / 48approvedNo
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v41 / 49approvedNo
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 49approvedNo
1010amnoncommon feces, control, united states of america, canis lupus familiaris, commonwealth of pennsylvania, dog2023-02-02v41 / 49approvedNo
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v31 / 50approvedNo
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 50approvedNo
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v41 / 51approvedNo
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v31 / 51approvedNo
196amnonlower in biofilms in water at 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water biofilm drinking water biofilm )2017-09-12v41 / 51approvedNo
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v31 / 51approvedNo
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v41 / 52approvedNo
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v41 / 52approvedNo
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v11 / 52approvedNo
278amnon high in periodontitis compared to control in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v41 / 52approvedNo
102amnon high in periodontitis compared to control in homo sapiens united states of america atlanta mouth 2017-04-04v41 / 53approvedNo
162amnon high in periodontitis compared to control in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v41 / 53approvedNo
196amnonlower in heated tap water 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water drinking water )2017-09-12v41 / 54approvedNo
944amnon high in crohn's disease crohn's disease compared to control in adult biopsy ireland large intestine 2022-11-26v31 / 54approvedNo
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v41 / 54approvedNo
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v41 / 55approvedNo
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v31 / 55approvedNo
775amnon high in lichen planus compared to control in homo sapiens saliva adult china jinan city prefecture 2021-04-24v41 / 56approvedNo
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v41 / 56approvedNo
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v41 / 56approvedNo
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v41 / 56approvedNo
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v31 / 56approvedNo
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v41 / 56approvedNo
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v11 / 57approvedNo
944amnoncommon control, adult, biopsy, ireland, large intestine2022-11-26v31 / 57approvedNo
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v41 / 58approvedNo
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v41 / 58approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v41 / 58approvedNo
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v31 / 59approvedNo
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v31 / 60approvedNo
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 60approvedNo
944amnon high in ulcerative colitis ulcerative colitis compared to control in adult biopsy ireland large intestine 2022-11-26v31 / 60approvedNo
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v41 / 60approvedNo
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v41 / 61approvedNo
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v41 / 61approvedNo
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v31 / 61approvedNo
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v31 / 61approvedNo
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v41 / 62approvedNo
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water biofilm )2017-09-12v41 / 62approvedNo
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v41 / 63approvedNo
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v31 / 65approvedNo
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v31 / 65approvedNo
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v31 / 66approvedNo
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v41 / 66approvedNo
968amnon high in atopic dermatitis compared to control in homo sapiens skin adult switzerland elbow zurich antecubital fossa 2022-12-23v11 / 66approvedNo
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v41 / 68approvedNo
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 68approvedNo
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v41 / 69approvedNo
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v41 / 69approvedNo
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v41 / 70approvedNo
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v41 / 70approvedNo
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v41 / 71approvedNo
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v41 / 71approvedNo
914amnon high in control compared to diarrhea in feces bos grunniens tibet autonomous region qinghai province yak 2022-06-26v31 / 71approvedNo
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in united states of america caecum gallus gallus chicken )2017-04-14v41 / 72approvedNo
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 72approvedNo
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v41 / 72approvedNo
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v31 / 72approvedNo
968amnon high in atopic dermatitis compared to control in homo sapiens skin adult switzerland neck zurich 2022-12-23v11 / 72approvedNo
1020amnon high in control compared to remission ulcerative colitis in feces homo sapiens adult japan human adult stage 2023-04-06v31 / 73approvedNo
22amnon high in hiv infection compared to control in feces homo sapiens united states of america 2016-11-28v41 / 74approvedNo
997amnon high in control no dental caries compared to dental caries dental caries in saliva child shandong province china 2-5 year-old child stage 6-year-old human stage 2022-12-30v31 / 74approvedNo
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v41 / 75approvedNo
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v41 / 75approvedNo
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v31 / 79approvedNo
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v31 / 79approvedNo
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens nasopharynx infant australia )2017-04-16v41 / 80approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v41 / 80approvedNo
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v41 / 81approvedNo
678amnon high in control compared to tooth disease black dental staining in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v31 / 81approvedNo
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v41 / 81approvedNo
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 82approvedNo
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v41 / 82approvedNo
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v41 / 83approvedNo
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v41 / 83approvedNo
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens nasopharynx infant australia )2017-04-16v41 / 83approvedNo
959amnoncommon feces, homo sapiens, control, united states of america, child, state of california, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 83approvedNo
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v41 / 83approvedNo
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v41 / 83approvedNo
1021amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens obesity obese body mass index status russia irkutsk adolescent stage 2023-04-06v31 / 84approvedNo
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v41 / 85approvedNo
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v41 / 86approvedNo
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v41 / 88approvedNo
914amnon high in diarrhea compared to control in feces bos grunniens tibet autonomous region qinghai province yak 2022-06-26v31 / 88approvedNo
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v41 / 89approvedNo
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v31 / 92approvedNo
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 92approvedNo
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v41 / 92approvedNo
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v31 / 92approvedNo
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v41 / 93approvedNo
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v41 / 93approvedNo
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 94approvedNo
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v41 / 94approvedNo
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v11 / 97approvedNo
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v11 / 98approvedNo
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v41 / 100approvedNo
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v41 / 100approvedNo
1017amnoncommon homo sapiens, control, adult, canada, calgary, rectal swab, human adult stage2023-04-02v41 / 101approvedNo
704amnon high in dental caries compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v31 / 102approvedNo
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v41 / 103approvedNo
973amnon high in footrot disease compared to control in farm research facility interdigital region skin ovis aries sheep pes united kingdom coventry 2023-01-26v11 / 103approvedNo
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v41 / 104approvedNo
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v41 / 106approvedNo
980amnoncommon feces, homo sapiens, control, china, hangzhou city prefecture2022-12-25v31 / 106approvedNo
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v41 / 107approvedNo
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v41 / 107approvedNo
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v41 / 107approvedNo
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v41 / 107approvedNo
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus c57bl/6 japan )2016-12-10v41 / 108approvedNo
997amnon high in dental caries dental caries compared to control no dental caries in saliva child shandong province china 2-5 year-old child stage 6-year-old human stage 2022-12-30v31 / 108approvedNo
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v41 / 112approvedNo
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v31 / 112approvedNo
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens nasopharynx adult belgium 2019-12-05v41 / 114approvedNo
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v31 / 115approvedNo
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 120approvedNo
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v41 / 120approvedNo
955amnon high in periodontitis periodontitis compared to control in canis lupus familiaris chile subgingival plaque dog adult organism subgingival dental plaque 2022-12-17v41 / 120approvedNo
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v41 / 121approvedNo
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v41 / 121approvedNo
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v41 / 121approvedNo
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v41 / 125approvedNo
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v41 / 126approvedNo
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 127approvedNo
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 127approvedNo
607amnoncommon feces, homo sapiens, control, germany2020-04-19v41 / 128approvedNo
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v41 / 131approvedNo
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v31 / 131approvedNo
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v31 / 132approvedNo
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v41 / 132approvedNo
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v41 / 133approvedNo
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v41 / 134approvedNo
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 136approvedNo
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v41 / 137approvedNo
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in research facility soil paddy field soil zhejiang province china )2018-12-02v41 / 141approvedNo
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v41 / 147approvedNo
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v31 / 149approvedNo
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v41 / 153approvedNo
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 154approvedNo
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v41 / 154approvedNo
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v41 / 155approvedNo
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v31 / 156approvedNo
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v31 / 160approvedNo
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v41 / 161approvedNo
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v41 / 162approvedNo
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v41 / 163approvedNo
1000amnoncommon feces, homo sapiens, control, female, adult, viet nam2022-12-31v31 / 170approvedNo
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v41 / 179approvedNo
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v41 / 180approvedNo
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v41 / 185approvedNo
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v41 / 191approvedNo
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica oleracea brassica china )2017-07-27v41 / 191approvedNo
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v41 / 193approvedNo
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v41 / 193approvedNo
959amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america child state of california los angeles 6-12 year-old child stage adolescent stage 2022-12-19v41 / 194approvedNo
866amnon high in control compared to stress restraint stress in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v41 / 196approvedNo
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v41 / 198approvedNo
944amnon high in control compared to ulcerative colitis ulcerative colitis in adult biopsy ireland large intestine 2022-11-26v31 / 199approvedNo
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in desert soil oil contaminated soil kuwait )2018-09-09v41 / 200approvedNo
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v31 / 207approvedNo
9amnonlower in sea water with coral ( high in control compared to porites astreoides in sea water bermuda )2016-10-27v41 / 211approvedNo
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in research facility soil paddy field soil zhejiang province china )2018-12-02v41 / 212approvedNo
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v31 / 214approvedNo
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v31 / 221approvedNo
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 225approvedNo
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 226approvedNo
916amnon high in antibiotic antimicrobial agent antibiotics supllemented diet compared to control normal diet in research facility caecum oryctolagus cuniculus kingdom of spain age 2 months rabbit 2022-07-04v41 / 226approvedNo
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v41 / 228approvedNo
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v41 / 231approvedNo
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v41 / 238approvedNo
916amnon high in control control diet compared to antibiotic antibiotics supllemented diet in research facility caecum oryctolagus cuniculus kingdom of spain age 2 months rabbit 2022-07-04v41 / 246approvedNo
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v41 / 248approvedNo
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in desert soil oil contaminated soil kuwait )2018-09-09v41 / 251approvedNo
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v41 / 255approvedNo
944amnon high in control compared to crohn's disease crohn's disease in adult biopsy ireland large intestine 2022-11-26v31 / 256approvedNo
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 263approvedNo
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v41 / 263approvedNo
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v41 / 265approvedNo
698amnon high in disease ph 5-6 acute oak decline plant disease compared to control ph 6-7 in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v31 / 266approvedNo
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 275approvedNo
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v41 / 281approvedNo
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v41 / 282approvedNo
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 288approvedNo
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america oryza sativa state of california rice root )2017-07-25v41 / 288approvedNo
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v41 / 301approvedNo
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v41 / 301approvedNo
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v41 / 319approvedNo
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v11 / 334approvedNo
902amnoncommon feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v41 / 350approvedNo
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in pig manure compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough compared to control high fusarium cumulative disease incidence in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v41 / 360approvedNo
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 364approvedNo
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v41 / 390approvedNo
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 394approvedNo
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v41 / 402approvedNo
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v41 / 412approvedNo
166amnonhigher in river sediment under mussles compared to control ( high in mussel unionidae compared to control in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v41 / 422approvedNo
698amnon high in control ph 6-7 compared to disease ph 5-6 acute oak decline plant disease in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v31 / 452approvedNo
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v41 / 459approvedNo
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v31 / 504approvedNo
448amnoncommon in healthy horse feces (common feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v41 / 508approvedNo
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v41 / 671approvedNo
902amnon high in control compared to salmonella gastroenteritis salmonellosis in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 679approvedNo
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v41 / 698approvedNo
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v31 / 700approvedNo
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v41 / 708approvedNo
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 754approvedNo
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v31 / 761approvedNo
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v41 / 770approvedNo
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v41 / 836approvedNo
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v41 / 950approvedNo
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v41 / 992approvedNo
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v41 / 1023approvedNo
154amnon high in uranium high uranium compared to control in sediment soil australia kakadu national park 2017-06-29v41 / 1080approvedNo
448amnon high in control compared to equine grass sickness disease in feces farm equus caballus horse united kingdom 2019-01-08v41 / 1084approvedNo
698amnoncommon control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v31 / 1115approvedNo
171amnon high in control compared to drought environment in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v41 / 1164approvedNo
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v41 / 1663approvedNo
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v41 / 1681approvedNo
83amnon high in diet restricted feed compared to control normal feed in rumen bos taurus ireland holstein-friesian bull 2017-03-05v41 / 1735approvedNo
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v41 / 1755approvedNo
507amnonlower in mine tailing contaminated sediment compared to uncontaminated control ( high in control compared to contaminated sediment in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v41 / 1825approvedNo
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v41 / 1893approvedNo

Problems / suggestions? Please email info AT dbbact DOT org