Summary for ontology term: control

Number of annotations with term: 576

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.082153
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.076487
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTCAACCGCGGGATTGCTTTTGGAACTGTCATGCTAGAGTGCAGGAGGGGTGAGCGGAATTCCTAG0.065156
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.062323
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.062323
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTAGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.062323
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCCG0.062323
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.059490
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.059490
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATAATTGGGCGTAAAGGGCGCGTAGGCGGCTCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.059490

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.164444
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.124444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.106667
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.084444
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.080000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.075556
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.071111
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.066667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.066667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.062222

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.154461
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.150685
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.148688
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.147025
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.142672
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.140888
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.139205
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG0.137380
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTCAACCGCGGGATTGCTTTTGGAACTGTCATGCTAGAGTGCAGGAGGGGTGAGCGGAATTCCTAG0.136364
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTAGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.134763

Annotations:

common ontology terms
term enrichment score
TermScore
control0.735666
LOWER IN control0.566693
homo sapiens0.441872
feces0.406955
adult0.327601
research facility0.301137
united states of america0.287016
china0.232687
mus musculus0.207191
mouse0.190321
child0.146653
male0.106244
caecum0.097778
subgingival plaque0.090387
mouth0.080579
female0.079643
kingdom of spain0.079511
saliva0.078385
antibiotic0.076120
LOWER IN antibiotic0.072687
c57bl/60.067389
state of california0.064220
canada0.059172
czech republic0.058824
rat0.057851
dentition0.056680
periodontitis0.055000
nasopharynx0.053097
soil0.050251
australia0.050209
zhejiang province0.049505
sprague dawley0.046719
equus caballus0.046091
horse0.046091
belgium0.045652
sus scrofa0.045455
pig0.045455
LOWER IN periodontitis0.044691
c57bl/6j0.043189
united kingdom0.042650
dog0.040893
canis lupus familiaris0.040398
guangzhou city prefecture0.040268
tongue0.040000
mouth mucosa0.039801
oral cavity0.039370
human adult stage0.038729
crohn's disease0.038122
LOWER IN crohn's disease0.038122
homosexual0.037131
msm0.037131
obsolete_juvenile stage0.035909
LOWER IN ulcerative colitis0.034130
LOWER IN hiv infection0.033985
farm0.033578
province of alberta0.033557
municipality of beijing0.033003
israel0.032787
rattus norvegicus0.032733
rhizosphere0.032699
chicken0.032468
gallus gallus0.032336
age 6 weeks0.031949
rumen0.031120
italy0.031120
hiv infection0.030651
kingdom of the netherlands0.030303
dermal layer of tongue0.030075
male organism0.030030
japan0.028846
germany0.027739
atlanta0.027586
ulcerative colitis0.027344
nanjing city prefecture0.027211
taiwan0.027027
mus musculoides0.027027
nyulmc0.027027
nod/shiltj (no. 001976, jackson labs)0.027027
subgingival dental plaque0.026846
vagina0.026432
rattus0.025751
sweden0.025157
brazil0.024540
colon0.023870
10-15-years-old human0.023870
diabetes mellitus0.023729
amsterdam0.023729
ascending colon0.023729
russia0.023589
LOWER IN colitis0.023589
bos taurus0.023112
human late adulthood stage0.022913
intestine0.022590
leaf0.021672
sediment0.021516
diet0.021440
LOWER IN type i diabetes mellitus0.020548
type i diabetes mellitus0.020548
depth 5cm0.020478
balb/c0.020408
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease10.000000
LOWER IN crohn's disease10.000000
periodontitis2.750000
LOWER IN periodontitis2.250000
atlanta2.000000
diarrhea1.500000
LOWER IN diarrhea1.500000
bermuda1.000000
LOWER IN ulcerative colitis1.000000
phoenix1.000000
stress1.000000
LOWER IN stress1.000000
LOWER IN sinusitis1.000000
sinusitis1.000000
jordan1.000000
glasgow1.000000
rem sleep behavior disorder1.000000
LOWER IN rem sleep behavior disorder1.000000
irritable bowel syndrome1.000000
LOWER IN irritable bowel syndrome1.000000
citrus unshiu1.000000
constipation1.000000
LOWER IN constipation1.000000
LOWER IN salmonellosis1.000000
salmonellosis1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
acute pancreatitis1.000000
pancreatitis1.000000
LOWER IN spinal cord injury1.000000
spinal cord injury1.000000
dental caries1.000000
LOWER IN dental caries1.000000
malaria1.000000
LOWER IN malaria1.000000
schistosomiasis1.000000
urinary schistosomiasis1.000000
LOWER IN schistosomiasis1.000000
LOWER IN urinary schistosomiasis1.000000
bile1.000000
control0.962162
LOWER IN control0.945946
ulcerative colitis0.875000
antibiotic0.812500
LOWER IN hiv infection0.800000
hiv infection0.800000
LOWER IN antibiotic0.750000
probiotics0.750000
LOWER IN type i diabetes mellitus0.750000
type i diabetes mellitus0.750000
parkinson's disease0.750000
LOWER IN parkinson's disease0.750000
LOWER IN systemic lupus erythematosus0.750000
systemic lupus erythematosus0.750000
LOWER IN metronidazole0.714286
metronidazole0.714286
colon0.666667
autistic disorder0.666667
LOWER IN autistic disorder0.666667
homosexual0.666667
msm0.666667
LOWER IN pancreatic cancer0.666667
LOWER IN hymenolepis diminuta0.666667
hymenolepis diminuta0.666667
chronic periodontitis0.666667
probiotic0.666667
restricted feed0.666667
LOWER IN drought environment0.666667
drought environment0.666667
larvae0.666667
LOWER IN plant disease0.666667
endosphere0.666667
plant disease0.666667
nanjing city prefecture0.666667
mouth neoplasm0.666667
LOWER IN mouth neoplasm0.666667
LOWER IN polycystic ovary syndrome0.666667
10-15-years-old human0.666667
subgingival plaque0.642857
guangzhou city prefecture0.600000
LOWER IN ampicillin0.600000
ampicillin0.600000
nasopharynx0.600000
sprague dawley0.600000
depth 5cm0.600000
LOWER IN parasitic helminthiasis infectious disease0.600000
parasitic helminthiasis infectious disease0.600000
obesity0.571429
LOWER IN anorexia nervosa0.500000
anorexia nervosa0.500000
LOWER IN chronic gastritis0.500000
tongue0.500000
porites astreoides0.500000
LOWER IN porites astreoides0.500000
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
LOWER IN low anterior resection0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
Fraction of annotations for the query sequences containing the term
TermScore
control0.595486
homo sapiens0.559028
feces0.553819
LOWER IN control0.404514
adult0.331597
united states of america0.328125
research facility0.262153
china0.222222
mus musculus0.133681
mouse0.121528
child0.086806
male0.065972
caecum0.057292
female0.050347
subgingival plaque0.048611
saliva0.046875
kingdom of spain0.045139
mouth0.045139
antibiotic0.039931
LOWER IN antibiotic0.038194
state of california0.036458
c57bl/60.036458
soil0.034722
canada0.034722
czech republic0.031250
dentition0.031250
rat0.031250
periodontitis0.027778
nasopharynx0.027778
australia0.027778
sus scrofa0.027778
pig0.027778
zhejiang province0.026042
belgium0.024306
sprague dawley0.024306
united kingdom0.024306
equus caballus0.024306
horse0.024306
c57bl/6j0.022569
LOWER IN periodontitis0.022569
human adult stage0.022569
canis lupus familiaris0.022569
dog0.022569
tongue0.020833
guangzhou city prefecture0.020833
mouth mucosa0.020833
oral cavity0.020833
crohn's disease0.019097
LOWER IN crohn's disease0.019097
rhizosphere0.019097
farm0.019097
homosexual0.019097
msm0.019097
obsolete_juvenile stage0.019097
LOWER IN ulcerative colitis0.017361
LOWER IN hiv infection0.017361
rumen0.017361
israel0.017361
italy0.017361
rattus norvegicus0.017361
gallus gallus0.017361
chicken0.017361
germany0.017361
age 6 weeks0.017361
male organism0.017361
province of alberta0.017361
municipality of beijing0.017361
hiv infection0.015625
japan0.015625
dermal layer of tongue0.015625
kingdom of the netherlands0.015625
taiwan0.013889
ulcerative colitis0.013889
vagina0.013889
mus musculoides0.013889
nyulmc0.013889
nod/shiltj (no. 001976, jackson labs)0.013889
sweden0.013889
rattus0.013889
brazil0.013889
subgingival dental plaque0.013889
atlanta0.013889
nanjing city prefecture0.013889
colon0.012153
leaf0.012153
intestine0.012153
russia0.012153
diet0.012153
bos taurus0.012153
LOWER IN colitis0.012153
human late adulthood stage0.012153
diabetes mellitus0.012153
amsterdam0.012153
sediment0.012153
ascending colon0.012153
10-15-years-old human0.012153
sea water0.010417
sichuan province0.010417
balb/c0.010417
colitis0.010417
Exp. ID User ID Description Date Region Flag Sequences
37amnonhigh in tomato plant leaves compared to plastic control ( high in solanum lycopersicum compared to control in leaf maryland county )2016-12-09v4No1 / 1
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 1
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 1
384amnon high in asthma compared to control in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 1
607amnon high in control compared to parkinson's disease in homo sapiens nasopharynx germany nasal wash 2020-04-19v4No1 / 1
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 1
857amnon high in bacillus thuringiensis toxin producing cotton compared to control in agricultural feature state of north carolina whole body larvae third instar larva stage helicoverpa zea bollworm cotton field 2022-01-10v3No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in estradiol bisphenol a compared to control in research facility intestine danio rerio zebra fish china )2017-04-09v4No1 / 1
114amnon high in control compared to contaminated water polychlorinated biphenyl 126 pcb in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in neutrophil hirschsprung disease high neutrophils compared to control low neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in control low neutrophils compared to neutrophil hirschsprung disease high neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in feces caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 1
144amnon high in ancylostoma compared to control in feces canis lupus familiaris australia dog 2017-04-19v4No1 / 1
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 1
680amnon high in probiotic bifidobacterium longum probiotic compared to control in feces homo sapiens obesity adult russia novosibirsk 2028-03-04v3No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in feces homo sapiens pathogen israel )2017-10-05v4No1 / 1
702amnon high in control compared to clostridium difficile infection in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 1
736amnon high in control compared to parasitic helminthiasis infectious disease helminthiasis in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 1
9amnonmuch higher when coral is present ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 2
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 2
344amnon high in control compared to hiv infection in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 2
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 2
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 2
604amnon high in bronchitis infectious bronchitis virus compared to control in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 2
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 2
102amnon high in hiv infection compared to control in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 2
114amnon high in contaminated water polychlorinated biphenyl 126 pcb compared to control in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 2
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in feces homo sapiens child africa )2018-12-08v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female obesity adult china shanghai district 2028-03-17v3No1 / 2
227amnonlower in infants with respiratory illness compared to healthy controls ( high in control compared to respiratory system disease in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
239amnon high in control compared to carcinoma colorectal adenocarcinoma colorectal cancer in feces homo sapiens united states of america 2017-11-08v4No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 2
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 2
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 3
16amnon high in diarrhea compared to control in feces felis catus state of california 2016-11-08v4No1 / 3
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v4No1 / 3
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens united states of america adult commonwealth of massachusetts caribbean latino human late adulthood stage 2021-06-18v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
607amnon high in rem sleep behavior disorder parkinson's disease compared to control in feces homo sapiens germany 2020-04-19v4No1 / 3
104amnon high in control compared to periodontitis in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v4No1 / 3
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v4No1 / 3
902amnondominant feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 3
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 4
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 4
555amnon high in autistic disorder autism compared to control in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 4
570amnon high in visceral leishmaniasis compared to control in feces homo sapiens india bihar state 2019-12-16v3No1 / 4
597amnon high in gout compared to control in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in feces homo sapiens germany 2020-04-19v4No1 / 4
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 4
685amnon high in control compared to helicobacter pylori infectious disease in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 4
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in feces united states of america mus musculus balb/c state of texas mouse )2017-10-06v4No1 / 4
716amnon high in halitosis chronic bad breath compared to control in homo sapiens tongue adult dermal layer of tongue china 2028-05-22v3No1 / 4
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens city infant vellore district india 2-month-old human stage )2018-05-14v4No1 / 5
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 5
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 5
831amnon high in control compared to pancreatic cancer in feces homo sapiens adult israel 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 5
607amnon high in parkinson's disease compared to control in homo sapiens nasopharynx germany nasal wash 2020-04-19v4No1 / 5
96amnon high in control compared to systemic lupus erythematosus in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
104amnon high in periodontitis compared to control in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 5
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to atopic dermatitis allergy in united states of america skin felis catus cat )2017-07-05v4No1 / 5
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v4No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 5
448amnonhigh freq. in healthy horse feces (dominant feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 5
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in feces homo sapiens united states of america )2017-10-23v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 5
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
384amnon high in control compared to asthma in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 6
698amnondominant control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 6
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 6
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
239amnon high in carcinoma colorectal adenocarcinoma colorectal cancer compared to control in feces homo sapiens united states of america 2017-11-08v4No1 / 6
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 6
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 7
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 7
378amnon high in periodontitis compared to control in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 7
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
685amnon high in helicobacter pylori infectious disease compared to control in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
730amnon high in crohn's disease compared to control in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 7
37amnonhigh in tomato plant leaves compared to plastic controls ( high in solanum lycopersicum compared to control in leaf maryland county )2016-12-09v4No1 / 8
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 8
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 8
535amnon high in dysplasia of cervix compared to control in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 9
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v4No1 / 9
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 9
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam homosexual msm 2020-05-31v4No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 9
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v4No1 / 9
678amnon high in tooth disease black dental staining compared to control in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens child tanzania age 1-3 years pemba island 2-year-old human stage 1-year-old human stage 2021-01-25v3No1 / 9
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v3No1 / 10
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 10
378amnon high in control compared to periodontitis in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 10
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
857amnon high in control compared to bacillus thuringiensis toxin producing cotton in agricultural feature state of north carolina whole body larvae third instar larva stage helicoverpa zea bollworm cotton field 2022-01-10v3No1 / 10
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
700amnon high in caecum compared to colon in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
2amnon high in control compared to anorexia nervosa in feces homo sapiens 2016-10-05v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to braces teeth braces in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 11
96amnon high in systemic lupus erythematosus compared to control in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 11
787amnondominant control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 11
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 11
202amnon high in neoplasm mouth neoplasm cancer compared to control in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 11
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
796amnon high in control compared to graves' disease in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 12
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 12
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 13
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 13
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
232amnonhigher in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in ulcer wound compared to control in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus balb/c japan )2016-12-10v4No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
576amnon high in aphthous stomatitis compared to control in homo sapiens adult czech republic mouth 2020-01-09v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 15
102amnon high in control compared to hiv infection in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 15
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 16
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 16
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
570amnon high in control compared to visceral leishmaniasis in feces homo sapiens india bihar state 2019-12-16v3No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v3No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
212amnondominant feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 18
84amnonincreases in drought in late time points ( high in timepoint drought environment compared to control in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v4No1 / 18
102amnon high in control compared to hiv infection in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in feces homo sapiens child africa )2018-12-08v4No1 / 18
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
555amnon high in control compared to autistic disorder autism in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
866amnondominant feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin foot australia )2017-11-05v4No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
2amnon high in anorexia nervosa compared to control in feces homo sapiens 2016-10-05v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 20
704amnon high in periodontitis compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth adult czech republic 2020-01-09v3No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
911amnon high in spinal cord injury compared to control in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 21
911amnondominant feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 22
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 23
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 24
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 26
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 26
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
154amnonstrongly correlated with high uranium concentration ( high in uranium high urnaium compared to control in sediment soil australia kakadu national park )2017-06-29v4No1 / 28
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
693amnon high in polycystic ovary syndrome compared to control in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 29
704amnon high in control compared to dental caries in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 29
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
774amnon high in tonsillitis compared to control in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 30
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 31
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in feces united states of america felis catus state of colorado cat )2018-12-25v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 31
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 34
127amnonhigher in vaccinated chickens ( high in vaccination salmune vaccination compared to control in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 34
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 35
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 36
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 36
196amnonhigher in heated tap water 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water drinking water )2017-09-12v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 37
84amnondisappears in drought in late time points ( high in control compared to timepoint drought environment in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v4No1 / 37
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in feces united states of america research facility mus musculus mouse cba/j mice )2017-08-24v4No1 / 37
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 37
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 38
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 38
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
51amnon high in hiv infection compared to control in feces homo sapiens united states of america 2017-01-19v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
555amnon high in control compared to autistic disorder autism in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 43
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
866amnon high in stress restraint stress compared to control in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 44
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 45
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 45
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 47
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
96amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 48
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
196amnonlower in biofilms in water at 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 51
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 52
278amnon high in periodontitis compared to control in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 52
102amnon high in periodontitis compared to control in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 53
162amnon high in periodontitis compared to control in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
196amnonlower in heated tap water 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water drinking water )2017-09-12v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 55
775amnon high in lichen planus compared to control in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 56
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 58
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 62
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 65
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
22amnon high in hiv infection compared to control in feces homo sapiens united states of america 2016-11-28v4No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 79
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 80
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 81
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v4No1 / 100
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 100
704amnon high in dental caries compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 102
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 108
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 120
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 121
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 134
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 141
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 191
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 193
866amnon high in control compared to stress restraint stress in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 198
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in desert soil oil contaminated soil kuwait )2018-09-09v4No1 / 200
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
9amnonlower in sea water with coral ( high in control compared to porites astreoides in sea water bermuda )2016-10-27v4No1 / 211
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 225
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 226
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in desert soil oil contaminated soil kuwait )2018-09-09v4No1 / 251
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 255
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 265
698amnon high in disease ph 5-6 acute oak decline plant disease compared to control ph 6-7 in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v3No1 / 266
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 288
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
902amnoncommon feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 350
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in pig manure compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough compared to control high fusarium cumulative disease incidence in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v4No1 / 360
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 394
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 412
166amnonhigher in river sediment under mussles compared to control ( high in mussel unionidae compared to control in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 422
698amnon high in control ph 6-7 compared to disease ph 5-6 acute oak decline plant disease in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v3No1 / 452
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 504
448amnoncommon in healthy horse feces (common feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 508
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
902amnon high in control compared to salmonella gastroenteritis salmonellosis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 679
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
154amnon high in uranium high uranium compared to control in sediment soil australia kakadu national park 2017-06-29v4No1 / 1080
448amnon high in control compared to equine grass sickness disease in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 1084
698amnoncommon control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 1115
171amnon high in control compared to drought environment in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 1164
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v4No1 / 1663
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
83amnon high in diet restricted feed compared to control normal feed in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1735
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 1755
507amnonlower in mine tailing contaminated sediment compared to uncontaminated control ( high in control compared to contaminated sediment in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1825
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893

Problems / suggestions? Please email info AT dbbact DOT org