Summary for ontology term: cystic fibrosis

Number of annotations with term: 13

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCAAGGGCAAGGCACGGTCTTTGGCCGTGTTGAGTGGATTGTTCGAATAAGCACCGGCTAACTAC0.076923
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGAGAGATCCTGAACCAGCCAAGCCGCGTGAGGGAAGACGGCCCTATGGGTTGTAAACCTCTTTTGTCGGAGAACAAAACCCGGGACGTGTCCCGGACTGCGTGTATCCGAAGAAAAAGCATCGGCTAACT0.076923
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGGGTGAAGAAGGTCTTCGGATCGTAAAACCCTGTTGTTAGAGAAGAAAGTGCGTGAGAGTAACTGTTCACGTTTCGACGGTATCTAACCAGAAAGCCACGGC0.076923
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGATTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.076923
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAAAAGACGCCACGCGTGGCGTTCCGAGAGTACCCGAAGAAAAAGCATCGGCTAACT0.076923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.076923
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTG0.076923
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.076923
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGACTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.076923
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__DesulfovibrionaceaeTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGAAGGGAAGAAAGTGCGTGGTGCTAATCAGCCGCGTATTGACGGTACCTTCAAAGGAAGCACCGGC0.076923

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTGGGGAATATTGCGCAATGGACGAAAGTCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGGAGGGAAGAAAGCGCATGGCGCCAATCAGCCATGCGTTGACGGTACCTCCAAAGGAAGCGCCGGC0.500000
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGCCGGGGAGCAACGGGGTCCTTGCGAGGGCCCAATGAGAGTACCCGGAGAAAAAGCATCGGCTAAC0.500000
d__Bacteria;p__"Proteobacteria"TGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTCTTCGGATCGTAAACCTCTGTCAGCAGGGAAGAACGGTCACTGTGCTAATCAGCAGTGAATTGACGGTACCTGCAAAGGAAGCACCGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AnaerotruncusTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGGGAAGACGGTCTTCGGATTGTAAACCTCTGTCTTTGGGGAAGAAAATGACGGTACCCAAAGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCTTACGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACTGCCCTATGGGTTGTAAACCTCTTTTGTCAGGGAGCAACGCCGGCTACGTGTAGCCGGACTGAGAGTACCTGAAGAAAAAGCATCGGCTAAC0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAACAGGGTATGCATACCCTCTTGTATGTACCATATGAATAAGGATCGGCTAACT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAACAGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGGACAATGGGGGAAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTGTCAGCAGGGAAGAAAGAAATGACGGTACCTGACCAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACGGCCCTACGGGTTGTAAACTTCTTTTGTCAGGGAGCAATTGGGTCCACGCGTGGGCTTAGCGAGAGTACCTGAAGAAAAAGCATCGGCTAAC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAGGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCAACGCCGCGTGAAGGAAGACGGTTTTCGGATTGTAAACTTCTATCAATAGGGAAGAAAGAAATGACGGTACCTAAATAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.260870
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGCCGCGTGAGGGAATAAGGCCCTATGGGTCGTAAACCTCTTTTGTCGGGGAACAAAAGCGGGGACGCGTCCCCGTCTGCGTGTACCCGAAGAAAAAGCATCGGCTAACT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGCAAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAAAGCGCGGTACGAGTGCCGTGAAGGAGAGTACCCGAAGAAAAAGCATCGGCTAAC0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGGGTGAAGAAGATCTTCGGATCGTAAAACCCTGTTGTTAGAGAAGAAAGTGCGTGAGAGTAACTGTTCACGTTTCGACGGTATCTAACCAGAAAGCCACGGC0.235294
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCAAGGGCAAGGCACGGTCTTTGGCCGTGTTGAGTGGATTGTTCGAATAAGCACCGGCTAACTAC0.230769
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGATTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAATGTTCCACGTGTGGGATTTTGTATGTACCATATGAATAAGGATCGGCTAACT0.214286
TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGCCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG0.214286
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGACTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.210526
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__DesulfovibrionaceaeTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGAAGGGAAGAAAGTGCGTGGTGCTAATCAGCCGCGTATTGACGGTACCTTCAAAGGAAGCACCGGC0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
cystic fibrosis0.774194
mild disease course0.480000
state of new hampshire0.480000
seattle0.380952
colonized germ free0.380952
cftr s489x0.315789
bordeaux0.235294
protected brush sampling0.235294
mucus0.195122
6-12 year-old child stage0.173913
sputum0.173913
lung0.150943
bronchoalveolar lavage0.148148
LOWER IN cystic fibrosis0.133333
LOWER IN cftr s489x0.133333
LOWER IN sinusitis0.125000
paranasal sinus0.125000
sinusoidal space0.125000
mucosa0.111111
french republic0.093023
child0.037383
mouse0.029740
mus musculus0.026936
united states of america0.021012
homo sapiens0.018274
research facility0.010974
feces0.010300
adult0.009608
LOWER IN control0.009569
control0.009346
Fraction of dbbact annotations with this term covered by the query
TermScore
cystic fibrosis0.666667
LOWER IN cystic fibrosis0.500000
LOWER IN cftr s489x0.500000
seattle0.500000
colonized germ free0.500000
cftr s489x0.500000
bordeaux0.500000
mild disease course0.500000
state of new hampshire0.500000
protected brush sampling0.500000
LOWER IN sinusitis0.333333
paranasal sinus0.333333
sinusoidal space0.333333
6-12 year-old child stage0.200000
mucosa0.200000
sputum0.200000
mucus0.142857
bronchoalveolar lavage0.142857
lung0.100000
french republic0.066667
child0.021277
mouse0.015625
mus musculus0.014085
united states of america0.010638
homo sapiens0.009259
research facility0.005587
feces0.005208
LOWER IN control0.005102
control0.004975
adult0.004854
Fraction of annotations for the query sequences containing the term
TermScore
cystic fibrosis0.923077
united states of america0.846154
homo sapiens0.692308
feces0.461538
adult0.461538
mild disease course0.461538
state of new hampshire0.461538
research facility0.307692
mus musculus0.307692
mouse0.307692
seattle0.307692
colonized germ free0.307692
mucus0.307692
lung0.307692
cftr s489x0.230769
child0.153846
french republic0.153846
bordeaux0.153846
6-12 year-old child stage0.153846
sputum0.153846
bronchoalveolar lavage0.153846
protected brush sampling0.153846
control0.076923
LOWER IN cystic fibrosis0.076923
LOWER IN cftr s489x0.076923
LOWER IN sinusitis0.076923
mucosa0.076923
paranasal sinus0.076923
sinusoidal space0.076923
LOWER IN control0.076923
Number of experiments associating the term to the sequence
TermScore
cystic fibrosis4.000000
united states of america3.000000
homo sapiens3.000000
feces2.000000
control1.000000
LOWER IN cystic fibrosis1.000000
LOWER IN cftr s489x1.000000
research facility1.000000
mus musculus1.000000
mouse1.000000
seattle1.000000
colonized germ free1.000000
cftr s489x1.000000
child1.000000
french republic1.000000
bordeaux1.000000
6-12 year-old child stage1.000000
LOWER IN sinusitis1.000000
mucosa1.000000
paranasal sinus1.000000
sinusoidal space1.000000
sputum1.000000
adult1.000000
mild disease course1.000000
state of new hampshire1.000000
mucus1.000000
lung1.000000
bronchoalveolar lavage1.000000
protected brush sampling1.000000
LOWER IN control1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
228amnonhigh in sinus brush of CF patients compared to other sinusitis ( high in cystic fibrosis compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v41 / 1approvedNo
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v41 / 6approvedNo
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v41 / 7approvedNo
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v41 / 8approvedNo
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v41 / 10approvedNo
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v41 / 14approvedNo
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v31 / 20approvedNo
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v31 / 22approvedNo
895amnondominant feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v41 / 25approvedNo
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v31 / 25approvedNo
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v41 / 33approvedNo
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v31 / 64approvedNo
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v41 / 65approvedNo

Problems / suggestions? Please email info AT dbbact DOT org