Summary for ontology term: cystic fibrosis

Number of annotations with term: 13

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCAAGGGCAAGGCACGGTCTTTGGCCGTGTTGAGTGGATTGTTCGAATAAGCACCGGCTAACTAC0.111111
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGAGAGATCCTGAACCAGCCAAGCCGCGTGAGGGAAGACGGCCCTATGGGTTGTAAACCTCTTTTGTCGGAGAACAAAACCCGGGACGTGTCCCGGACTGCGTGTATCCGAAGAAAAAGCATCGGCTAACT0.111111
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGGGTGAAGAAGGTCTTCGGATCGTAAAACCCTGTTGTTAGAGAAGAAAGTGCGTGAGAGTAACTGTTCACGTTTCGACGGTATCTAACCAGAAAGCCACGGC0.111111
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGATTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.111111
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAAAAGACGCCACGCGTGGCGTTCCGAGAGTACCCGAAGAAAAAGCATCGGCTAACT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.111111
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTG0.111111
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.111111
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGACTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.111111
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__DesulfovibrionaceaeTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGAAGGGAAGAAAGTGCGTGGTGCTAATCAGCCGCGTATTGACGGTACCTTCAAAGGAAGCACCGGC0.111111

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTGGGGAATATTGCGCAATGGACGAAAGTCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTTTTCGGATCGTAAACCTCTGTCAGGAGGGAAGAAAGCGCATGGCGCCAATCAGCCATGCGTTGACGGTACCTCCAAAGGAAGCGCCGGC1.000000
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGCCGGGGAGCAACGGGGTCCTTGCGAGGGCCCAATGAGAGTACCCGGAGAAAAAGCATCGGCTAAC1.000000
d__Bacteria;p__"Proteobacteria"TGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGTCTTCGGATCGTAAACCTCTGTCAGCAGGGAAGAACGGTCACTGTGCTAATCAGCAGTGAATTGACGGTACCTGCAAAGGAAGCACCGGC1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AnaerotruncusTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGGGAAGACGGTCTTCGGATTGTAAACCTCTGTCTTTGGGGAAGAAAATGACGGTACCCAAAGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA1.000000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCTTACGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACTGCCCTATGGGTTGTAAACCTCTTTTGTCAGGGAGCAACGCCGGCTACGTGTAGCCGGACTGAGAGTACCTGAAGAAAAAGCATCGGCTAAC1.000000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAACAGGGTATGCATACCCTCTTGTATGTACCATATGAATAAGGATCGGCTAACT1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAACAGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGGACAATGGGGGAAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTGTCAGCAGGGAAGAAAGAAATGACGGTACCTGACCAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG1.000000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACGGCCCTACGGGTTGTAAACTTCTTTTGTCAGGGAGCAATTGGGTCCACGCGTGGGCTTAGCGAGAGTACCTGAAGAAAAAGCATCGGCTAAC1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAGGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA1.000000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGCCGCGTGAGGGAATAAGGCCCTATGGGTCGTAAACCTCTTTTGTCGGGGAACAAAAGCGGGGACGCGTCCCCGTCTGCGTGTACCCGAAGAAAAAGCATCGGCTAACT0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGCAAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAAAGCGCGGTACGAGTGCCGTGAAGGAGAGTACCCGAAGAAAAAGCATCGGCTAAC0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCAAGGGCAAGGCACGGTCTTTGGCCGTGTTGAGTGGATTGTTCGAATAAGCACCGGCTAACTAC0.315789
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCAACGCCGCGTGAAGGAAGACGGTTTTCGGATTGTAAACTTCTATCAATAGGGAAGAAAGAAATGACGGTACCTAAATAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.315789
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGGGTGAAGAAGATCTTCGGATCGTAAAACCCTGTTGTTAGAGAAGAAAGTGCGTGAGAGTAACTGTTCACGTTTCGACGGTATCTAACCAGAAAGCCACGGC0.307692
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGATTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCAAGTCGCGTGAGGGACTAAGGCCCTACGGGTCGTAAACCTCTTTTGCCGGGGATCAGTGCCCAGCTCGCGAGCTGGGAGGGAGCGTACCCGGAGAAAAAGCATCGGCTAAC0.266667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAAAAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCG0.266667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAATGTTCCACGTGTGGGATTTTGTATGTACCATATGAATAAGGATCGGCTAACT0.260870
TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGCCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG0.255319

Annotations:

common ontology terms
term enrichment score
TermScore
cystic fibrosis1.090909
mild disease course0.480000
state of new hampshire0.480000
seattle0.380952
colonized germ free0.380952
cftr s489x0.315789
bordeaux0.266667
protected brush sampling0.235294
mucus0.195122
6-12 year-old child stage0.173913
sputum0.173913
lung0.150943
bronchoalveolar lavage0.148148
LOWER IN cftr s489x0.133333
LOWER IN sinusitis0.133333
LOWER IN cystic fibrosis0.125000
sinusoidal space0.125000
paranasal sinus0.117647
french republic0.102564
mucosa0.060606
child0.047059
mouse0.033195
mus musculus0.030189
united states of america0.023948
homo sapiens0.021792
research facility0.013311
feces0.012565
adult0.011418
control0.010101
LOWER IN control0.010101
Fraction of dbbact annotations with this term covered by the query
TermScore
cystic fibrosis1.333333
bordeaux1.000000
LOWER IN cftr s489x0.500000
seattle0.500000
colonized germ free0.500000
cftr s489x0.500000
LOWER IN sinusitis0.500000
mild disease course0.500000
state of new hampshire0.500000
protected brush sampling0.500000
LOWER IN cystic fibrosis0.333333
sinusoidal space0.333333
paranasal sinus0.250000
6-12 year-old child stage0.200000
sputum0.200000
mucus0.142857
bronchoalveolar lavage0.142857
lung0.100000
french republic0.076923
mucosa0.050000
child0.027778
mouse0.017544
mus musculus0.015873
united states of america0.012146
homo sapiens0.011070
research facility0.006803
feces0.006369
adult0.005780
control0.005405
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
cystic fibrosis0.923077
united states of america0.846154
homo sapiens0.692308
feces0.461538
adult0.461538
mild disease course0.461538
state of new hampshire0.461538
research facility0.307692
mus musculus0.307692
mouse0.307692
seattle0.307692
colonized germ free0.307692
mucus0.307692
lung0.307692
cftr s489x0.230769
child0.153846
french republic0.153846
bordeaux0.153846
6-12 year-old child stage0.153846
sputum0.153846
bronchoalveolar lavage0.153846
protected brush sampling0.153846
control0.076923
LOWER IN cystic fibrosis0.076923
LOWER IN cftr s489x0.076923
LOWER IN sinusitis0.076923
mucosa0.076923
paranasal sinus0.076923
sinusoidal space0.076923
LOWER IN control0.076923
Exp. ID User ID Description Date Region Flag Sequences
228amnonhigh in sinus brush of CF patients compared to other sinusitis ( high in cystic fibrosis compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 1
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 6
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 8
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
895amnondominant feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 65

Problems / suggestions? Please email info AT dbbact DOT org