Summary for ontology term: denver

Number of annotations with term: 8

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGTAAGTTGGAAGTGAAATCCCGGGGCTTAACCCCGGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGGTGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTGGAAACTGTTTTGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.142857
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGCGCAAGTTAAATGTTTAAACTATCGGCTCAACTGATAGTCGCGTTTAAAACTGCGTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.133333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.133333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasCACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGCGCGTAGGCGGGACGACAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGTTGACCTTGAGACGAGACGAGGGAGGCGGAACAAGTGAA0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTTTGTTAAGTCGGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCTGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.117647
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCCCTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGAGGCTTGAGTATGTTTGAGGCAGGTGGAATGCGTGG0.117647
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGTACGGCAAGTTTGATGTGAAACCCTCGGGCTTAACCCGAGGCATGCATCGAAAACTACAGAACTAGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.117647

Annotations:

common ontology terms
term enrichment score
TermScore
denver0.666667
gay0.357143
homosexual0.263158
msm0.263158
heterosexual0.260870
msw0.260870
state of colorado0.200000
LOWER IN gay0.166667
LOWER IN heterosexual0.153846
LOWER IN msw0.153846
LOWER IN homosexual0.142857
LOWER IN msm0.142857
LOWER IN hiv infection0.111111
hiv infection0.111111
control0.010363
LOWER IN control0.010363
united states of america0.008065
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
denver0.500000
LOWER IN gay0.250000
gay0.250000
heterosexual0.200000
msw0.200000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
LOWER IN homosexual0.166667
LOWER IN msm0.166667
homosexual0.166667
msm0.166667
state of colorado0.111111
LOWER IN hiv infection0.100000
hiv infection0.100000
control0.005405
LOWER IN control0.005405
united states of america0.004049
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america1.000000
state of colorado1.000000
denver1.000000
gay0.625000
homosexual0.625000
msm0.625000
heterosexual0.375000
msw0.375000
LOWER IN gay0.125000
LOWER IN homosexual0.125000
LOWER IN msm0.125000
control0.125000
LOWER IN hiv infection0.125000
hiv infection0.125000
LOWER IN control0.125000
LOWER IN heterosexual0.125000
LOWER IN msw0.125000

Problems / suggestions? Please email info AT dbbact DOT org