Summary for ontology term: depth 0-20cm

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1TGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGAAGCCCCTTGGGGTGTAAACTCCTTTCGATCGGGAAGATAATGACGGTACCGATATAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.062500
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGAAGAAAAGCTCCGGGCTAATACCTTGGAGTCATGACGGTACCTGAAGAATAAGCACCGGC0.062500
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGGGACGAAGGCTTTCTGAGTTGTAAACCTCTTTCAGCAGGGACGATTGTGACGGTACCTGCAGAAGAAGCCCCGGCCAACTACGTGCCAGCAGCCGCGGT0.062500
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1TGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGAAGTCCCTTGGGACGTAAACTCCTTTCGATCGGGACGATTATGACGGTACCGGAAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.062500
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nakamurellaceae;g__NakamurellaTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCTCTGACGAAGCGCAAGTGACGGTAGGAGCAGAAGAAGCACCGGCCAACTACGTGCCAGCAGCCG0.062500
d__BacteriaTGGGGAATCTTGCGCAATGGCCTAACGGCTGACGCAGCGACGCCGCGTGAGGGATGAAGCTCTTCGGAGTGTAAACCTCTGTTGCCCGGGACGAATAGCGGATTTTTCCGACTTGACGGTACCGGGTGAGGAAGCACCGGCTAACTCCGT0.062500
d__BacteriaTGGGGAATATTGGGCAATGGACGCAAGTCTGACCCAGCGACGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAAAAGAAGCACCGGCTAACTATGTGCCAGCAGCCG0.062500
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__RhodanobacterTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTTATCAGGAACGAAATACTACGGGTTAATAACCTGTGGGGCTGACGGTACCTGAGGAATAAGCACCGGC0.062500
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TGGGGAATCTTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGATGAAGCCCTTCGGGGTGTAAAGCTCTTTCGGCAGGGACGATAATGACGGTACCTGCAGAAGAAGCTGCGGCTAACTACGTGCCAGCAGCCGCGGTA0.062500
d__BacteriaATTAGGAATCTTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGACGGCATTCGTGTTGTAAACCTCTTTTGTCGGGGAAGAAGAAAATGACGGTACCCGGCGAATAAGCCCCGGCTAACTACGTGCCAGCAGCCGC0.062500

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGCAGGGAGGAGAGGCTAATGGTTAATACCCATTAGATTAGACGTTACCTGCAGAATAAGCACCGGC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeTGGGGAATTTTGGACAATGGGGGAAACCCTGATCCAGCCATGCCGCGTGTATGAAGAAGGCCTTAGGGTTGTAAAGTACTTTTGTTAGGGAAGAAAAGCTAGTTTTTAATAAAAATTAGTGATGACGGTACCTAAAGAATAAGCACCGGC0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Propionibacteriaceae;g__PropionibacteriumTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCAACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTCGCCTGTGACGAAGCGTGAGTGACGGTAATGGGTAAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGCTAGGGACGAAGCTTTTTGTGACGGTACCTAGATAAGAAGCACCGGCTAACTACGTGCCAGCAGCC0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__DelftiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGGAACGAAAAAGCTTCTCCTAATACGAGAGGCCCATGACGGTACCGTAAGAATAAGCACCGGC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__PelomonasTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGAAGAAAAGGTTCTGGCTAATACCTGGGACTCATGACGGTACCTGAAGAATAAGCACCGGC0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__StenotrophomonasTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATACCGCGTGGGTGAAGAAGGCCTTCGGGTTGTAAAGCCCTTTTGTTGGGAAAGAAATCCAGCTGGTTAATACCCGGTTGGGATGACGGTACCCAAAGAATAAGCACCGGC0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGGGTAGGCGGCACTGCAAGTCGACTGTGAAATCTCCGAGCTTAACTCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCGG0.454545
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGCAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCTTTAAAACTGCATCGCTAGAATTGTGGAGAGGTGAGTGGAATTCCGAG0.454545
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaGACGGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGCAGGTGGCTGTTCAAGTCTGCTGTCAAATTCCAGGGCTCAACCCTGGTTCGGCAGTGGAAACTGGATAGCTAGAGTACGGTAGGGGCAGAGGGAATTCCTGG0.400000
d__Bacteria;p__"Proteobacteria"TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGCCGTGTCCTGTGTGAAAGCCCCGGGCTCAACCTGGGAATGGCATGGGAAACTGGCGGGCTTGAGTGTGGCAGAGGGGGGTGGAATTCCGCG0.380952
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGTAAGTCAGTGGTGAAATCTCCGAGCTTAACTCGGAAACTGCCATTGATACTATCTTTCTTGAATACCGTGGAGGTCAGCGGAATATGTCA0.380952
d__BacteriaAACGTAGGAGGCAAGCGTTATCCGGATTCACTGGGCGTAAAGCGCGTGCAGGTGGCCCGGTAAGTTGGATGTGAAATCTCCCGGCTCAACTGGGAGAGGTCATTCAATACTACCGTGCTTGAGAGCAGAAGAGGAAGATGGAATTCCCGG0.380952
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGCAAGTAAGTCAGTGGTGAAATCTCCGGGCTTAACCCGGAAACTGCCGTTGATACTATTTGCCTTGAATATCGTGGAGGTAAGCGGAATATGTCA0.380952
d__BacteriaTACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTTCTCAAGTCGGGCGTGAAATCTTCGGGCTTAACCTGGAAAAGTCGTTCGATACTGTCGAGCTAGAGTGTGGAAGAGGCTACTGGAATTCCGTG0.380952
d__Bacteria;p__Cyanobacteria/ChloroplastTACGGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGTAGGTGGTGGTTCAAGTCTGCTGTCAAAAACTGGGGCTTAACCCCAGAGCGGCGGTGGAAACTGAACTGCTAGAGTGTGGTAGGGGCAGAGGGAATTCCCGG0.380952
d__BacteriaTACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGACGCGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCGTGTCTGGAGCTATGCAGAGGTCGGTGGAATTGCCGG0.380952

Annotations:

common ontology terms
term enrichment score
TermScore
depth 0-20cm0.779221
limestone0.600000
fungicide0.600000
tobacco field0.600000
difenoconazole0.600000
without plants0.333333
tobacco plant present0.333333
ice0.285714
glacier0.222222
filtered 0.2um0.200000
surface0.193548
biochar0.178571
absence of tobacco plants0.111111
LOWER IN presence of tobacco plants0.111111
presence of tobacco plants0.111111
LOWER IN absence of tobacco plants0.111111
LOWER IN subsurface0.111111
LOWER IN depth 20-100cm0.111111
subsurface0.111111
depth 20-100cm0.111111
sweden0.105263
LOWER IN depth 0-20cm0.105263
ph 7-80.098361
LOWER IN surface0.095238
soil0.019934
china0.011538
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 0-20cm0.666667
absence of tobacco plants0.500000
LOWER IN presence of tobacco plants0.500000
limestone0.500000
fungicide0.500000
tobacco field0.500000
difenoconazole0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
without plants0.500000
tobacco plant present0.500000
ice0.333333
LOWER IN depth 0-20cm0.333333
surface0.200000
glacier0.200000
LOWER IN surface0.200000
filtered 0.2um0.166667
biochar0.125000
sweden0.066667
ph 7-80.052632
soil0.010101
china0.005814
Fraction of annotations for the query sequences containing the term
TermScore
depth 0-20cm0.937500
soil0.750000
ph 7-80.750000
limestone0.750000
fungicide0.750000
china0.750000
tobacco field0.750000
difenoconazole0.750000
biochar0.312500
glacier0.250000
sweden0.250000
filtered 0.2um0.250000
ice0.250000
without plants0.250000
tobacco plant present0.250000
surface0.187500
absence of tobacco plants0.062500
LOWER IN presence of tobacco plants0.062500
presence of tobacco plants0.062500
LOWER IN absence of tobacco plants0.062500
LOWER IN subsurface0.062500
LOWER IN depth 20-100cm0.062500
subsurface0.062500
depth 20-100cm0.062500
LOWER IN surface0.062500
LOWER IN depth 0-20cm0.062500
Exp. ID User ID Description Date Region Flag Sequences
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 12
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 78
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915

Problems / suggestions? Please email info AT dbbact DOT org