Summary for ontology term: depth 0-5cm

Number of annotations with term: 7

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGGAGGTGGCAAACGTTGCTCGGAATCACTGGGCTTAAAGGGCGTGTAGGCGGTCTTCCAAGTCGGGTGTGAAAGCCCTCGGCTCAACCGAGGAATTGCACACGATACTGGTCGACTAGAGTGCGGCAGGGGTAAGTGGAACTCCAGG0.125000
d__Bacteria;p__"Proteobacteria"TACGGAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTGAATTTAGTCAGGCGTGAAAGCCCCGGGCTTAACCCGGGAACTGCGTTTGATACTGATTTACTAGAATTCGAGAGAGGGTAGCGGAATTTCCAG0.125000
d__BacteriaTACAGAGGGTGCAAACGTTGTTCGGAATTACTGGGCATAAAGCGCACGTAGGCGGTCAGGTAAGTGTGAAGTGAAATCCCACGGCTCACCCGTGGAACTGCTTTGCATACTGCTTGACTAGAGGAAGGTAGGGGAGAGCAGAACTCTTGG0.125000
d__BacteriaTACGGAAGGGGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCGCGTAGGCGGTTTCGTATGTCCGCTGTGAAAGCCCACGGCTCAACCGTGGAAAGTCGGTGGAAACTGCGAAACTTGAGGCTGGGAGGGGCTGGTGGAATTCCCTG0.125000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTCAGTCAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCGATACTGCTGAGCTAGAGTATGGAAGAGGGAAGTGGAATTCCGGG0.125000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTGTTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGGCAAGCTAGAGTATGGGAGAGGGCTGTGGAATTCCACG0.125000
d__BacteriaTACGAAGGGCCCGAGCGTTGCGCGGAATCACTGGGCTTAAAGCGTACGTAGGCGGACAAGCAGGCATCTTGTGAAATCCCTCGGCTCAACCGAGGAATTGCTTGGTGAACCGCTTGTCTTGAGGCGAGTAGGGGCTGTCGGAACGATAGG0.125000
d__BacteriaTACGGGGGGGGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCTCGTAGGCGGCCACTTAAGTCGGTTGTGAAATCCCTCGGCTCAACCGGGGAACTGCGACCGAAACTGGGTGGCTTGAAGCCGGGAGAGGGATGCGGAATTCCAGG0.125000
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGCGCGCGTAGGCGGCTTGGTAAGTCGGATGTGAAATCCCGGGGCCCAACCCCGGAACTGCATTCGATACTGCCTGGCTAGAGTCCCGGAGAGGAAGGCAGAATTCCCGG0.125000
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGGGTGTAGGCGGCTTTGCAAGTCAGATGTGAAATCCCTGGGCCCAACCCAGGAACTGCATTTGATACTGCATCGCTAGAGTCCCGGAGAGGATGGCGGAATTCCAGG0.125000

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaGACGGAGAGCGCGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGTAGTTTTTGATAATTTTTAACTAAAAACGCAGAGTGTTCCTATGCGCTAGTTTTTTTAAAGATCAAACTAGTACTGATTAGAGGTTGGGGCAATTTCC0.615385
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGAGCGTAGGCGGGCATGTAAGTCAGTGGTGAAATCTTGGGGCTCAACCCCGAAACTGCCATTGATACTATGTGCCTTGGATCCTGTTGAGGTTTGCGGAATATGTCA0.533333
d__BacteriaCACGGAGAGCACGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGCTGCTGTTGTTAATTTTTAACCGAAATCGCGGAGTGTTCCTATGCGCTGGTTTTTTAGAAGATATAGCTGGTGTTAAAGATAGGTTGGGGCAATTTCC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTTTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGATGAAGACTGCAAGGCTTGAATCTGGCAGAGGGGGGGAGAATTCCACG0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGAGCGTAGGCCGGCATGTAAGTCAGTGGTGAAATCCTGGGGCTCAACCCCGGAACTGCCATTGATACTATGTGCCTTGGATCCTGTTGAGGTCTGCGGAATATGTCA0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCATTAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGATGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.470588
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTGTACAGTCAGATGTGAAATTCCCGGGCTTAACCTGGGGACTGCATTTGATACGTGCGGGCTAGAGTGTGAAAGAGGGTCGTGGAATTCCCAG0.461538
d__BacteriaCACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCATAATAGGGACTAATTTTCTAGAGTTTTATGAGAGAAGGAGCGAATTACCGGTGGAGAGTTGATATTTTGTGATACCGGTAGGA0.461538
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTTTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAATGGCATTTGTGACTGGAAGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.428571
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCTGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCTGGAAACTGGAGAGCTTGAGTACAGACGAGGGTGGCGGAATGGACGG0.400000

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 0-5cm0.666667
LOWER IN depth 8-10cm0.500000
lapland0.500000
LOWER IN lapland0.500000
depth (water) 4000m0.333333
snow0.250000
finland0.142857
LOWER IN finland0.142857
kingdom of norway0.125000
LOWER IN kingdom of norway0.125000
LOWER IN state of colorado0.111111
state of colorado0.111111
sweden0.066667
LOWER IN sweden0.066667
marine sediment0.058824
pacific ocean0.040000
LOWER IN united states of america0.004049
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
depth 0-5cm1.000000
snow0.857143
kingdom of norway0.428571
sweden0.428571
finland0.428571
lapland0.428571
united states of america0.428571
state of colorado0.428571
LOWER IN depth 8-10cm0.142857
marine sediment0.142857
pacific ocean0.142857
depth (water) 4000m0.142857
LOWER IN united states of america0.142857
LOWER IN state of colorado0.142857
LOWER IN kingdom of norway0.142857
LOWER IN sweden0.142857
LOWER IN finland0.142857
LOWER IN lapland0.142857

Problems / suggestions? Please email info AT dbbact DOT org