Summary for ontology term: diarrhea

Number of annotations with term: 23

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGCTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGAAGTGAAAACCCTGGGCTTAACCTGGGGACTGCTTTGGAAACTGTTAATCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.333333
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCCTGTAAGTCTAGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCCCGGAAACTACAGGGCTAGAGTATCGGAGAGGTGGACGGAACTGCACG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGTGTAGGCGGTTTGTTAAGCGTGTTGTGAAATTTAGGTGCTCAACATTTAACTTGCAGCGCGAACTGTCAGACTTGAGTACACGCAACGTATGCGGAATTCATGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGCTATTTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGTAGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.333333

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG2.000000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT2.000000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG2.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG2.000000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTTAACTCCGTATTGCGTTGGAAACTGCCAAACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.400000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGTAGTCAAGTCAGATGTGAAATCCTGTAGCTTAACTACAGAACTGCATTTGAAACTGACTATCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.400000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGTAGGTAAGTCAGTGGTGAAATCTCAGAGCTTAACTCTGAAACTGCCATTGATACTATTTATCTTGAATATTGTGGAGGTAAGCGGAATATGTCA0.400000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTACCAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCTTGCCTTTGAAACTGGTAGGCTGGAGTATCGGAGAGGTGGACGGAACTGCACG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCTGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Chromatiales;f__Chromatiaceae;g__RheinheimeraTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGTTGTTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCAAAACTGGACAACTAGAGTGTGTGAGAGGGGGGTAGAATTCCAAG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTATTAAGTCAGATGTGAAAGCCCTGGGCTCAACCTAGGAATCGCATTTGAAACTGACAAGCTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAGCTTGAGTCTCGTAGAGGGGGTAGAATTCCAGGTG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAAGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGTAGGCGGGATAGTCAGTCAGGTGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTACTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.333333

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
121amnoncausitive agent for acute diarrhea (other feces, homo sapiens, pathogen, bangladesh, diarrhea)2017-04-13v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in feces homo sapiens pathogen israel )2017-10-05v4No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
16amnon high in diarrhea compared to control in feces felis catus state of california 2016-11-08v4No1 / 3
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
207amnoncommon in people hospitalized with diarrhea (common feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 7
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263

Problems / suggestions? Please email info AT dbbact DOT org