Summary for ontology term: diet

Number of annotations with term: 100

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGGCGCAGACGGCGATGCAAGCCAGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTTGGAACTGCGTGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTGG0.129032
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGAGTAGGCGGCATGGTAAGCCAGATGTGAAAGCCTTGGGCTTAACCCGAGGATTGCATTTGGAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.129032
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTTGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.118280
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.118280
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.107527
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.107527
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.107527
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.107527
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.107527
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.096774

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCCTTGTAAGTTAGATGTGAAATCCTACGGCTTAACCGTAGAACTGCATCTAAAACTGTGAGGCTGGAGTGCAGGAGAGGTGAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGACGGGAAAGCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTACTTTTCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGCAAGTTGGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACCAAAACTATCTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTCCGCAGCCGGTTTATTAAGTATAGAATAAAACTTCGGGGCTCAACCCCGTCTCGTTCTATAAACTGATAGACTAGAGTGTGGTAGAGGCAAGTGGAATTTCTAGT0.263158
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCTGATGTGAAAGGTGTGGGCACAACCCGCACACTGCATTGGGAACTGTATGGCTAGAGTGTCGGAGGGGCAGGCGGAATTCCTGG0.263158
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.210526
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.210526
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.210526
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.210526
d__Bacteria;p__FirmicutesTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGTCCTGCAAGTCTGGAGTGAAACGCATGAGCTCAACTCATGCATGGCTTTGGAAACTGGAGGACTGGAGAGCAGGAGAGGGCGGTGGAACTCCATG0.210526

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGGCGCAGACGGCGATGCAAGCCAGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTTGGAACTGCGTGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTGG0.366337
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCACGGCAAGCCTGATGTGAAAGCCCGCGGCCCAACCGCGGGACTGCATTGGGAACTACCGGGCTGGAGTGCCGGAGAGGTAGGCGGAATTCCTAG0.322981
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.302703
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGCCAAGTCAGCTGTGAAAACTACGGGCTTAACTTGTAGACTGCAGTTGAAACTGGTTTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG0.287356
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTTGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.283871
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTCTGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGACTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.283465
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.272727
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.268817
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATGGCAAGTTGGGTGTTAAATCTACCGGCTCAACTGGTAGTCGCACTCAAAACTGCTATTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.263158
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCGATGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTGTTGCTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.261364

Annotations:

common ontology terms
term enrichment score
TermScore
diet0.568486
high fat diet0.527202
mouse0.402338
mus musculus0.394031
research facility0.242424
mouse chow0.227027
c57bl/60.226044
ketogenic diet0.208696
LOWER IN mouse chow0.206250
LOWER IN high fat diet0.178571
c57bl/6j0.172549
jackson laboratories0.153846
swiss webster0.142857
obesity0.134831
low fat diet0.126697
united states of america0.124472
ldlr-0.122807
feces0.122390
colon0.110092
state of washington0.109375
state of georgia0.097561
balb/c0.097561
rumen0.092308
male0.090452
LOWER IN control diet0.087719
LOWER IN ketogenic diet0.076190
western diet0.075472
jackson laboratory0.074074
ldlr -/-0.074074
c57bl/6ncrl0.074074
estonia0.071429
charles river laboratories0.068966
female0.066465
finland0.062500
bos taurus0.059701
LOWER IN low fat diet0.057416
humanized mouse0.057416
normal diet0.057143
f3666 diet0.056604
ireland0.056604
united kingdom0.054795
high bmi0.052632
control diet0.052632
sweden0.050000
digestive system0.045455
state of california0.039216
LOWER IN animal product diet0.038835
animal product diet0.038835
starch diet0.038835
american diet0.038835
LOWER IN american diet0.038835
LOWER IN western diet0.038835
argentina0.038462
liolaemus ruibali0.038462
drosophila melanogaster0.038462
field cricket0.038462
db/db mouse0.038462
holstein-friesian bull0.038462
strain 129s0.038462
janvier labs0.038462
age 18 weeks0.038462
LOWER IN caloric restriction diet0.038095
LOWER IN normal diet0.038095
caloric restriction diet0.038095
fruit fly0.037736
gryllinae0.037736
homo sapiens0.037383
obese body mass index status0.037037
state of nebraska0.037037
midgut0.036364
gastrointestinal system0.035088
cow0.032787
sus scrofa0.030303
pig0.030303
LOWER IN diet0.030075
control0.028070
adult0.027796
australia0.027397
germany0.025316
LOWER IN control0.023077
high fat diet + inulin0.019608
LOWER IN high fat diet + inulin0.019608
mixed0.019608
LOWER IN mixed0.019608
plant diet0.019608
LOWER IN plant diet0.019608
cmy diet0.019608
LOWER IN cmy diet0.019608
high fat diet + polydextrose0.019608
polydextrose0.019608
LOWER IN high fat diet + polydextrose0.019608
LOWER IN polydextrose0.019608
LOWER IN f1515 diet0.019608
f1515 diet0.019608
LOWER IN f3666 diet0.019608
LOWER IN cron diet0.019608
whole grain diet0.019608
LOWER IN whole wheat diet0.019608
cron diet0.019608
resistant starch type 4 diet0.019608
Fraction of dbbact annotations with this term covered by the query
TermScore
high fat diet0.916667
LOWER IN high fat diet0.833333
LOWER IN ketogenic diet0.800000
ketogenic diet0.800000
LOWER IN mouse chow0.733333
diet0.696970
low fat diet0.666667
LOWER IN low fat diet0.666667
LOWER IN animal product diet0.666667
animal product diet0.666667
swiss webster0.666667
starch diet0.666667
american diet0.666667
LOWER IN american diet0.666667
humanized mouse0.666667
colon0.666667
LOWER IN western diet0.666667
western diet0.666667
mouse chow0.600000
normal diet0.600000
jackson laboratory0.500000
ldlr -/-0.500000
high fat diet + inulin0.500000
LOWER IN high fat diet + inulin0.500000
mixed0.500000
argentina0.500000
liolaemus ruibali0.500000
LOWER IN mixed0.500000
plant diet0.500000
LOWER IN plant diet0.500000
cmy diet0.500000
drosophila melanogaster0.500000
LOWER IN cmy diet0.500000
high fat diet + polydextrose0.500000
polydextrose0.500000
c57bl/6ncrl0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
f3666 diet0.500000
LOWER IN f1515 diet0.500000
f1515 diet0.500000
LOWER IN f3666 diet0.500000
LOWER IN cron diet0.500000
whole grain diet0.500000
LOWER IN whole wheat diet0.500000
cron diet0.500000
resistant starch type 4 diet0.500000
metabolic syndrome x0.500000
bangladesh diet0.500000
LOWER IN bangladesh diet0.500000
chemically defined diet0.500000
LOWER IN cat chow0.500000
field cricket0.500000
cat chow0.500000
LOWER IN chemically defined diet0.500000
quinoa food product0.500000
LOWER IN ain-93g rodent diet0.500000
db/db mouse0.500000
ain-93g rodent diet0.500000
LOWER IN quinoa food product0.500000
inulin0.500000
ldlr-0.500000
linseed oil food product0.500000
ireland0.500000
age 100 days0.500000
LOWER IN sucram0.500000
sucram0.500000
linoleic acid0.500000
nih 31m chow0.500000
LOWER IN nih 31m chow0.500000
LOWER IN normal feed0.500000
holstein-friesian bull0.500000
LOWER IN restricted diet0.500000
strain s1290.500000
LOWER IN strain s1290.500000
strain 129s0.500000
plant based diet0.500000
LOWER IN plant based diet0.500000
corn diet0.500000
40mdgs diet0.500000
LOWER IN 27cds diet0.500000
LOWER IN 55cs diet0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
clover hay diet0.500000
LOWER IN fresh clover diet0.500000
camel0.500000
camelus dromedarius0.500000
lactobacillus plantarum0.500000
LOWER IN lactobacillus plantarum0.500000
regular mouse chow0.500000
high growth0.500000
LOWER IN low growth0.500000
low growth0.500000
LOWER IN high growth0.500000
very high sugar diet0.500000
LOWER IN high sugar diet0.500000
janvier labs0.500000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.800000
mus musculus0.730000
feces0.720000
mouse0.710000
united states of america0.650000
diet0.480000
high fat diet0.370000
c57bl/60.230000
mouse chow0.140000
LOWER IN mouse chow0.120000
homo sapiens0.120000
ketogenic diet0.120000
c57bl/6j0.110000
female0.110000
jackson laboratories0.100000
LOWER IN high fat diet0.100000
male0.090000
state of georgia0.080000
obesity0.080000
swiss webster0.080000
balb/c0.080000
low fat diet0.070000
adult0.070000
state of washington0.070000
ldlr-0.070000
colon0.060000
rumen0.060000
LOWER IN control diet0.050000
jackson laboratory0.040000
ldlr -/-0.040000
LOWER IN ketogenic diet0.040000
estonia0.040000
high bmi0.040000
digestive system0.040000
united kingdom0.040000
finland0.040000
c57bl/6ncrl0.040000
control0.040000
LOWER IN control0.040000
bos taurus0.040000
sweden0.040000
charles river laboratories0.040000
western diet0.040000
state of california0.040000
LOWER IN low fat diet0.030000
control diet0.030000
f3666 diet0.030000
normal diet0.030000
humanized mouse0.030000
ireland0.030000
argentina0.020000
liolaemus ruibali0.020000
LOWER IN animal product diet0.020000
animal product diet0.020000
drosophila melanogaster0.020000
fruit fly0.020000
starch diet0.020000
american diet0.020000
LOWER IN caloric restriction diet0.020000
LOWER IN normal diet0.020000
LOWER IN diet0.020000
caloric restriction diet0.020000
LOWER IN american diet0.020000
midgut0.020000
australia0.020000
gryllinae0.020000
field cricket0.020000
obese body mass index status0.020000
db/db mouse0.020000
gastrointestinal system0.020000
sus scrofa0.020000
pig0.020000
holstein-friesian bull0.020000
strain 129s0.020000
LOWER IN western diet0.020000
state of nebraska0.020000
cow0.020000
germany0.020000
janvier labs0.020000
age 18 weeks0.020000
high fat diet + inulin0.010000
LOWER IN high fat diet + inulin0.010000
mixed0.010000
LOWER IN high fiber0.010000
stomach0.010000
high fiber0.010000
LOWER IN mixed0.010000
small intestine0.010000
formula fed0.010000
LOWER IN breast milk0.010000
LOWER IN breast fed0.010000
nasal cavity0.010000
nasopharynx0.010000
infant0.010000
kingdom of the netherlands0.010000
plant diet0.010000
LOWER IN plant diet0.010000
cmy diet0.010000
LOWER IN starch diet0.010000
LOWER IN cmy diet0.010000
Exp. ID User ID Description Date Region Flag Sequences
244amnon high in diet cmy diet compared to starch diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
244amnon high in diet starch diet compared to cmy diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 1
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 2
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in research facility stomach argentina liolaemus ruibali )2017-02-25v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in diet american diet compared to bangladesh diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in farm rumen ovis aries child ireland sheep lamb age 100 days )2019-02-26v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to body mass index high growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in diet starch diet resistant starch type 4 diet compared to control diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 6
63amnon high in diet plant based diet compared to animal product diet in feces homo sapiens united states of america 2017-04-12v4No1 / 6
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in research facility small intestine argentina liolaemus ruibali )2017-02-25v4No1 / 8
413amnondominant feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in diet bangladesh diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
494amnondominant research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
326amnondominant united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 15
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
214amnondominant feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in diet chemically defined diet compared to cat chow in digestive system research facility midgut colon australia gryllinae field cricket )2018-04-27v4No1 / 19
457amnondominant feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 20
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 31
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 40
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 42
211amnon high in male compared to female in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 47
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
324amnonlower in crickets fed chemically defined diet compared to cat chow diet ( high in diet cat chow compared to chemically defined diet in digestive system research facility midgut colon australia gryllinae field cricket )2018-04-27v4No1 / 51
413amnon high in high fat diet compared to mouse chow in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 51
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to high fat diet western diet very high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 62
326amnon high in diet high fat diet compared to mouse chow in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 65
211amnonCommon in multiple mouse strains feces (common feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 68
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in diet whole grain diet compared to normal diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 71
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 83
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 83
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
214amnoncommon feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 89
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 97
413amnoncommon feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 101
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
326amnoncommon united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 122
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
413amnon high in mouse chow compared to high fat diet in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 163
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 186
326amnon high in diet mouse chow compared to high fat diet in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 189
372amnon high in high fat diet compared to mouse chow in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 199
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
123amnon high in diet normal diet regular mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 209
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 227
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
551amnon high in diet clover hay diet compared to fresh clover diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 291
494amnon high in mouse chow compared to diet high fat diet western diet in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 293
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
83amnon high in diet restricted feed compared to control normal feed in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1735

Problems / suggestions? Please email info AT dbbact DOT org