Summary for ontology term: diet

Number of annotations with term: 104

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGGCGCAGACGGCGATGCAAGCCAGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTTGGAACTGCGTGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTGG0.123711
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGAGTAGGCGGCATGGTAAGCCAGATGTGAAAGCCTTGGGCTTAACCCGAGGATTGCATTTGGAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.123711
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTTGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.113402
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.113402
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.103093
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.103093
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.103093
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.103093
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.103093
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.092784

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCCTTGTAAGTTAGATGTGAAATCCTACGGCTTAACCGTAGAACTGCATCTAAAACTGTGAGGCTGGAGTGCAGGAGAGGTGAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGACGGGAAAGCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTACTTTTCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGCAAGTTGGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACCAAAACTATCTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.263158
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTCCGCAGCCGGTTTATTAAGTATAGAATAAAACTTCGGGGCTCAACCCCGTCTCGTTCTATAAACTGATAGACTAGAGTGTGGTAGAGGCAAGTGGAATTTCTAGT0.263158
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCTGATGTGAAAGGTGTGGGCACAACCCGCACACTGCATTGGGAACTGTATGGCTAGAGTGTCGGAGGGGCAGGCGGAATTCCTGG0.263158
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.210526
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.210526
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.210526
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.210526
d__Bacteria;p__FirmicutesTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGTCCTGCAAGTCTGGAGTGAAACGCATGAGCTCAACTCATGCATGGCTTTGGAAACTGGAGGACTGGAGAGCAGGAGAGGGCGGTGGAACTCCATG0.210526

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGGCGCAGACGGCGATGCAAGCCAGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTTGGAACTGCGTGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTGG0.359223
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCACGGCAAGCCTGATGTGAAAGCCCGCGGCCCAACCGCGGGACTGCATTGGGAACTACCGGGCTGGAGTGCCGGAGAGGTAGGCGGAATTCCTAG0.315152
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.296296
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGCCAAGTCAGCTGTGAAAACTACGGGCTTAACTTGTAGACTGCAGTTGAAACTGGTTTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG0.280899
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTTGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.276730
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTCTGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGACTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.274809
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.267327
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.263158
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATGGCAAGTTGGGTGTTAAATCTACCGGCTCAACTGGTAGTCGCACTCAAAACTGCTATTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.256410
d__Bacteria;p__FirmicutesTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGTCCTGCAAGTCTGGAGTGAAACGCATGAGCTCAACTCATGCATGGCTTTGGAAACTGGAGGACTGGAGAGCAGGAGAGGGCGGTGGAACTCCATG0.255924

Annotations:

common ontology terms
term enrichment score
TermScore
high fat diet0.555556
diet0.555332
mouse0.402018
mus musculus0.394254
c57bl/60.254717
mouse chow0.237154
research facility0.232511
LOWER IN mouse chow0.216216
ketogenic diet0.201681
LOWER IN high fat diet0.189655
c57bl/6j0.163873
jackson laboratories0.143885
swiss webster0.137931
low fat diet0.122271
united states of america0.118798
ldlr-0.118644
feces0.117300
obesity0.115385
state of washington0.100719
state of georgia0.095238
balb/c0.095238
rumen0.086643
LOWER IN control diet0.084034
male0.076271
LOWER IN ketogenic diet0.073394
western diet0.072727
jackson laboratory0.071429
ldlr -/-0.071429
c57bl/6ncrl0.071429
colon0.069364
estonia0.068966
charles river laboratories0.066667
female0.063584
finland0.060606
bos taurus0.057143
male organism0.055556
LOWER IN low fat diet0.055300
humanized mouse0.055300
normal diet0.055046
f3666 diet0.054545
ireland0.053812
united kingdom0.052632
control diet0.050420
high bmi0.050000
south korea0.050000
sweden0.047619
digestive system0.044444
state of california0.037736
LOWER IN animal product diet0.037383
animal product diet0.037383
american diet0.037383
LOWER IN american diet0.037383
LOWER IN western diet0.037383
liolaemus ruibali0.037037
drosophila melanogaster0.037037
starch diet0.037037
field cricket0.037037
db/db mouse0.037037
holstein-friesian bull0.037037
strain 129s0.037037
janvier labs0.037037
LOWER IN caloric restriction diet0.036697
LOWER IN normal diet0.036697
caloric restriction diet0.036697
fruit fly0.036364
gryllinae0.036364
age 18 weeks0.036364
obese body mass index status0.035714
state of nebraska0.035714
homo sapiens0.035191
argentina0.035088
midgut0.035088
gastrointestinal system0.033898
cow0.031746
sus scrofa0.029412
pig0.029412
LOWER IN diet0.029197
control0.027211
adult0.026022
australia0.025316
germany0.023810
LOWER IN control0.022388
high fat diet + inulin0.018868
LOWER IN high fat diet + inulin0.018868
mixed0.018868
LOWER IN mixed0.018868
plant diet0.018868
LOWER IN plant diet0.018868
cmy diet0.018868
LOWER IN cmy diet0.018868
high fat diet + polydextrose0.018868
polydextrose0.018868
LOWER IN high fat diet + polydextrose0.018868
LOWER IN polydextrose0.018868
LOWER IN f1515 diet0.018868
f1515 diet0.018868
LOWER IN f3666 diet0.018868
LOWER IN cron diet0.018868
whole grain diet0.018868
LOWER IN whole wheat diet0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
high fat diet1.000000
LOWER IN high fat diet0.916667
LOWER IN mouse chow0.800000
LOWER IN ketogenic diet0.800000
ketogenic diet0.800000
diet0.696970
mouse chow0.666667
low fat diet0.666667
LOWER IN low fat diet0.666667
LOWER IN animal product diet0.666667
animal product diet0.666667
swiss webster0.666667
american diet0.666667
LOWER IN american diet0.666667
humanized mouse0.666667
LOWER IN western diet0.666667
western diet0.666667
normal diet0.600000
jackson laboratory0.500000
ldlr -/-0.500000
high fat diet + inulin0.500000
LOWER IN high fat diet + inulin0.500000
liolaemus ruibali0.500000
mixed0.500000
LOWER IN mixed0.500000
plant diet0.500000
LOWER IN plant diet0.500000
drosophila melanogaster0.500000
cmy diet0.500000
starch diet0.500000
LOWER IN cmy diet0.500000
c57bl/6ncrl0.500000
high fat diet + polydextrose0.500000
polydextrose0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
f3666 diet0.500000
LOWER IN f1515 diet0.500000
f1515 diet0.500000
LOWER IN f3666 diet0.500000
LOWER IN cron diet0.500000
whole grain diet0.500000
LOWER IN whole wheat diet0.500000
cron diet0.500000
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
bangladesh diet0.500000
LOWER IN bangladesh diet0.500000
field cricket0.500000
chemically defined diet0.500000
LOWER IN cat chow0.500000
cat chow0.500000
LOWER IN chemically defined diet0.500000
LOWER IN ain-93g rodent diet0.500000
db/db mouse0.500000
quinoa food product0.500000
ain-93g rodent diet0.500000
LOWER IN quinoa food product0.500000
inulin0.500000
ldlr-0.500000
age 100 days0.500000
linseed oil food product0.500000
LOWER IN sucram0.500000
sucram0.500000
linoleic acid0.500000
nih 31m chow0.500000
LOWER IN nih 31m chow0.500000
holstein-friesian bull0.500000
LOWER IN normal feed0.500000
LOWER IN restricted diet0.500000
strain s1290.500000
LOWER IN strain s1290.500000
strain 129s0.500000
plant based diet0.500000
LOWER IN plant based diet0.500000
corn diet0.500000
40mdgs diet0.500000
LOWER IN 27cds diet0.500000
LOWER IN 55cs diet0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
lactobacillus plantarum0.500000
LOWER IN lactobacillus plantarum0.500000
regular mouse chow0.500000
LOWER IN low growth0.500000
high growth0.500000
low growth0.500000
LOWER IN high growth0.500000
janvier labs0.500000
very high sugar diet0.500000
LOWER IN high sugar diet0.500000
high sugar diet0.500000
LOWER IN very high sugar diet0.500000
LOWER IN caloric restriction diet0.400000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.807692
mus musculus0.740385
feces0.730769
mouse0.721154
united states of america0.625000
diet0.461538
high fat diet0.384615
c57bl/60.259615
mouse chow0.144231
LOWER IN mouse chow0.125000
homo sapiens0.115385
ketogenic diet0.115385
c57bl/6j0.105769
LOWER IN high fat diet0.105769
female0.105769
jackson laboratories0.096154
male0.086538
state of georgia0.076923
obesity0.076923
swiss webster0.076923
balb/c0.076923
low fat diet0.067308
adult0.067308
ldlr-0.067308
state of washington0.067308
colon0.057692
rumen0.057692
LOWER IN control diet0.048077
jackson laboratory0.038462
ldlr -/-0.038462
LOWER IN ketogenic diet0.038462
high bmi0.038462
estonia0.038462
south korea0.038462
male organism0.038462
digestive system0.038462
united kingdom0.038462
c57bl/6ncrl0.038462
finland0.038462
control0.038462
LOWER IN control0.038462
bos taurus0.038462
charles river laboratories0.038462
sweden0.038462
western diet0.038462
state of california0.038462
LOWER IN low fat diet0.028846
control diet0.028846
f3666 diet0.028846
normal diet0.028846
humanized mouse0.028846
ireland0.028846
liolaemus ruibali0.019231
argentina0.019231
LOWER IN animal product diet0.019231
animal product diet0.019231
drosophila melanogaster0.019231
fruit fly0.019231
starch diet0.019231
american diet0.019231
LOWER IN caloric restriction diet0.019231
LOWER IN normal diet0.019231
LOWER IN diet0.019231
caloric restriction diet0.019231
LOWER IN american diet0.019231
australia0.019231
gryllinae0.019231
field cricket0.019231
midgut0.019231
obese body mass index status0.019231
db/db mouse0.019231
gastrointestinal system0.019231
sus scrofa0.019231
pig0.019231
holstein-friesian bull0.019231
strain 129s0.019231
LOWER IN western diet0.019231
cow0.019231
state of nebraska0.019231
germany0.019231
janvier labs0.019231
age 18 weeks0.019231
high fat diet + inulin0.009615
LOWER IN high fat diet + inulin0.009615
stomach0.009615
mixed0.009615
LOWER IN high fiber0.009615
small intestine0.009615
high fiber0.009615
LOWER IN mixed0.009615
kingdom of the netherlands0.009615
nasopharynx0.009615
nasal cavity0.009615
infant0.009615
formula fed0.009615
LOWER IN breast fed0.009615
LOWER IN breast milk0.009615
plant diet0.009615
LOWER IN plant diet0.009615
cmy diet0.009615
Exp. ID User ID Description Date Region Flag Sequences
244amnon high in cmy diet diet compared to starch diet in drosophila melanogaster fruit fly research facility digestive system united kingdom 2017-11-15v4No1 / 1
244amnon high in diet starch diet compared to cmy diet in drosophila melanogaster fruit fly research facility digestive system united kingdom 2017-11-15v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 1
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v4No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 5
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
63amnon high in diet plant based diet compared to animal product diet in homo sapiens united states of america feces 2017-04-12v4No1 / 6
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in liolaemus ruibali argentina research facility small intestine )2017-02-25v4No1 / 8
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 12
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
710amnondominant ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 16
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 18
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 19
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in chemically defined diet diet compared to cat chow in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 19
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v3No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 42
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 49
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
324amnonlower in crickets fed chemically defined diet compared to cat chow diet ( high in cat chow diet compared to chemically defined diet in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 65
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 71
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 75
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 83
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 137
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 163
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 189
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735

Problems / suggestions? Please email info AT dbbact DOT org