Summary for ontology term: duodenum

Number of annotations with term: 49

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.184211
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.157895
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.131579
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.131579
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.131579
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.105263
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.105263
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.105263
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGTGTAGGTGGCTCATTAAGTCACATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATGTGATACTGGTGGTGCTAGAATATGTGAGAGGGAAGTAGAATTCCAG0.105263
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.105263

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.307692
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTGACAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGCCGGACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.307692
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATTTGTGACTGCAGGACTAGAGTTCATCAGAGGGGGGTGGAATTCCAAG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.230769
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGTAGTGCATTGGAAACTGGAAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.230769
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTTTTAAGCGTGTTGTGAAATACTGTCGCTCAACGACAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAATGTAGGCGGAATTCGTCG0.230769

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGATAGTCAGTCAGGTGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTACTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.218182
TAACAAAAATTAAGCCATAAACGAAAGTTTGACTAAGCCATATTGACTAGGGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTGACCCAAGCTAACAGGAGTACGGCGTAAAGCGTGTTAAAGCATCATACTAAATAGAGTTA0.181818
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCTGGGCTTAACCTAGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.169014
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae"TACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGTTATGCAAGTCAGGGGTGAAAACTTACGGCTCAACCGTGAGCTTGCCTTTGAAACTGTGTGACTAGAGTACTGGAGAGGTGGGCGGAACTACACG0.161290
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTAAACAAGTCAGGGGTGAAAACTTGCAGCTCAACTGCAAGCTTGCCTTTGAAACTGATTAACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.153846
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAGGCCCTTCGGGGAGATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGC0.150943
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTGGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCGACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTTGTTGGGGAACAAGCGAGAGCGAGGGTACCCTTCGAATAAGGACCGGCTAACTACGTGCCAGCAGCCG0.150943
d__Bacteria;p__SR1;g__SR1_genera_incertae_sedisTACGTAGGTCTCAAGCGTTATCCGGATTTACTGGGCGTAAAGTGTCCGTAGTCTGAATTGTAAGTCTGTTTTCAAATCCTACGACTCAATCGTAGAAAGGGAGTGGATACTGCAATTCTAGAAGTATCTAGGGGTTAGTGGAATTTCCGG0.148148
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.142857
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGGTAGCAAGTCAGATGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTGTTACTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.139535

Annotations:

common ontology terms
term enrichment score
TermScore
duodenum0.878049
LOWER IN duodenum0.410742
jejunum0.338983
LOWER IN jejunum0.250000
ileum0.214477
ovis aries0.211765
state of wyoming0.196721
centrocercus urophasianus0.196721
greater sage-grouse0.196721
sheep0.179775
small intestine0.179104
new zealand0.164384
lamb0.164384
LOWER IN ileum0.153846
age 6 weeks0.151899
edmonton0.150943
canis latrans0.150943
jinzhou city prefecture0.140351
new delhi0.140351
LOWER IN caecum0.130152
gastrointestinal system0.126984
caecum0.117647
colon0.115385
LOWER IN colon0.115385
LOWER IN left colon0.109091
bangui0.109091
antananarivo0.109091
stunted growth0.109091
LOWER IN right colon0.106195
india0.103896
central african republic0.103448
madagascar0.103448
adult organism0.098765
bird0.094488
western australia0.078431
sus scrofa0.077519
pig0.077519
left colon0.075472
right colon0.074074
LOWER IN small intestine0.072727
chicken0.070796
age 1 year0.070175
gallus gallus0.068376
LOWER IN rectum0.066667
rectum0.066667
united kingdom0.060976
dog0.060976
stomach0.060606
LOWER IN stomach0.060606
canis lupus familiaris0.055866
wild0.055172
canada0.053691
child0.047478
mus musculus0.045714
africa0.045326
male0.044199
australia0.042105
descending colon0.040000
LOWER IN descending colon0.040000
anatomical space0.039604
dairy0.039216
ascending colon0.039216
LOWER IN transverse colon0.039216
transverse colon0.039216
LOWER IN ascending colon0.039216
LOWER IN antananarivo0.039216
LOWER IN bangui0.039216
LOWER IN gizzard0.039216
gizzard0.039216
age 30 days0.038462
LOWER IN madagascar0.038462
LOWER IN central african republic0.038462
esophagus0.037736
LOWER IN esophagus0.037736
research facility0.037677
obsolete_juvenile stage0.033898
united states of america0.030761
italy0.028986
feces0.027548
LOWER IN feces0.027548
mouth0.027397
LOWER IN mouth0.027397
homo sapiens0.014328
china0.010855
coyote0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
duodenum1.090909
jejunum1.000000
LOWER IN jejunum1.000000
colon1.000000
LOWER IN colon1.000000
edmonton1.000000
canis latrans1.000000
descending colon1.000000
LOWER IN descending colon1.000000
western australia1.000000
LOWER IN duodenum0.909091
dairy0.500000
ascending colon0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
transverse colon0.500000
left colon0.500000
LOWER IN ascending colon0.500000
jinzhou city prefecture0.500000
new delhi0.500000
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
stunted growth0.500000
state of wyoming0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
LOWER IN gizzard0.500000
gizzard0.500000
LOWER IN right colon0.400000
right colon0.400000
age 30 days0.333333
small intestine0.333333
LOWER IN small intestine0.333333
central african republic0.333333
LOWER IN madagascar0.333333
madagascar0.333333
LOWER IN central african republic0.333333
LOWER IN ileum0.312500
ileum0.312500
gastrointestinal system0.285714
ovis aries0.250000
new zealand0.250000
lamb0.250000
esophagus0.250000
LOWER IN esophagus0.250000
age 1 year0.250000
sheep0.200000
age 6 weeks0.200000
LOWER IN rectum0.181818
rectum0.181818
india0.142857
LOWER IN caecum0.138889
caecum0.138889
adult organism0.125000
stomach0.117647
LOWER IN stomach0.117647
obsolete_juvenile stage0.100000
bird0.076923
chicken0.062500
sus scrofa0.062500
pig0.062500
gallus gallus0.058824
italy0.050000
united kingdom0.043478
dog0.043478
australia0.043478
wild0.041667
mouth0.041667
LOWER IN mouth0.041667
canada0.040000
anatomical space0.038462
canis lupus familiaris0.038462
mus musculus0.031746
male0.030303
child0.027778
africa0.026316
research facility0.020408
united states of america0.016194
feces0.015924
LOWER IN feces0.015924
homo sapiens0.007380
china0.005814
coyote0.000000
Fraction of annotations for the query sequences containing the term
TermScore
duodenum0.734694
united states of america0.306122
LOWER IN duodenum0.265306
research facility0.244898
homo sapiens0.244898
jejunum0.204082
ovis aries0.183673
sheep0.163265
ileum0.163265
child0.163265
africa0.163265
LOWER IN jejunum0.142857
new zealand0.122449
lamb0.122449
age 6 weeks0.122449
LOWER IN caecum0.122449
small intestine0.122449
state of wyoming0.122449
bird0.122449
centrocercus urophasianus0.122449
greater sage-grouse0.122449
LOWER IN ileum0.102041
feces0.102041
LOWER IN feces0.102041
caecum0.102041
sus scrofa0.102041
pig0.102041
united kingdom0.102041
canis lupus familiaris0.102041
dog0.102041
male0.081633
canada0.081633
wild0.081633
adult organism0.081633
edmonton0.081633
canis latrans0.081633
coyote0.081633
gastrointestinal system0.081633
mus musculus0.081633
gallus gallus0.081633
chicken0.081633
china0.081633
jinzhou city prefecture0.081633
new delhi0.081633
india0.081633
colon0.061224
LOWER IN colon0.061224
LOWER IN left colon0.061224
LOWER IN right colon0.061224
central african republic0.061224
bangui0.061224
madagascar0.061224
antananarivo0.061224
stunted growth0.061224
anatomical space0.040816
stomach0.040816
LOWER IN rectum0.040816
rectum0.040816
LOWER IN stomach0.040816
left colon0.040816
right colon0.040816
LOWER IN small intestine0.040816
australia0.040816
age 1 year0.040816
western australia0.040816
dairy0.020408
italy0.020408
obsolete_juvenile stage0.020408
age 30 days0.020408
ascending colon0.020408
descending colon0.020408
esophagus0.020408
mouth0.020408
LOWER IN esophagus0.020408
LOWER IN mouth0.020408
LOWER IN transverse colon0.020408
transverse colon0.020408
LOWER IN ascending colon0.020408
LOWER IN descending colon0.020408
LOWER IN madagascar0.020408
LOWER IN antananarivo0.020408
LOWER IN central african republic0.020408
LOWER IN bangui0.020408
LOWER IN gizzard0.020408
gizzard0.020408
Exp. ID User ID Description Date Region Flag Sequences
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to caecum duodenum jejunum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
301amnonhost 18S dna (dog or cat or human) (other united states of america, duodenum, canis lupus familiaris, dog)2018-03-05v4No1 / 1
558amnon high in duodenum compared to gizzard in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 1
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
301amnondominant united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 9
649amnondominant research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
898amnon high in duodenum jejunum compared to feces ascending colon descending colon in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 11
898amnoncommon duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
898amnondominant duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
905amnondominant research facility, duodenum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 15
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
649amnon high in duodenum jejunum compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 18
558amnondominant united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v4No1 / 22
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens duodenum child africa 2018-12-08v4No1 / 33
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
649amnoncommon research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
558amnon high in gizzard compared to duodenum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 48
14amnon high in feces caecum transverse colon left colon right colon compared to stomach duodenum jejunum ileum in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 51
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
898amnon high in feces ascending colon descending colon compared to duodenum jejunum in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
905amnoncommon research facility, duodenum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 200
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
13amnon high in feces rectum caecum colon compared to stomach esophagus duodenum ileum mouth in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 316
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
558amnon high in caecum compared to duodenum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 488
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org