Summary for ontology term: equine grass sickness

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaCACGTAGGGGGCGAGCGTTGTTCGGATTCATTGGGCGTAAAGGGCGCGCGGGCGGCCGGGCGAGCCTGCCGTGAAATCCCCGTGCTCAACACGGGGGGGTCGGCGGGGACTGTCCGGCTGGAGTACCGGAAGCGGCGGCGGAATTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGTCGGAGAGGCAATCGGAATTCCGTG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGCTTAATAAGTCGAGCGTGAAAATGCGGGGCTCAACCCCGTATGGCGCTGGAAACTGTTAGGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.250000
d__BacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTTTTGTAAGTCAGAGGTGTAATCCCACGGCTTAACCGTGGAACTGCCTTTGATACTGCATAACTTGGATCCGGGAGAGGACAGCGGAATTCCAGG0.250000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTAGTAAGTCTGATGTGAAAATGCGGGGCTCAACCCCGTATTGCGTTGGAAACTGCTAAACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCGCTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGGTGCCTTGAGTGCAGTATAGGCAGGCGGAATTCGTGG0.250000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGTGATACAGGTCTGGAGGTGAAAGCCCGAAGCTAAACTTCGGGAAGCCCCGGAAACCGGATCACTGGAGTGCGGAAGAGGATCGTGGAATTCCATG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAACCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGAACTGCTTTGGAAACTGGTTAGCTAGAGTGTCGGAGAGGTGAGTGGAATTCCCAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCTGGCAAGTCTGATGTGAAAGGCAGGGGCTCAACTCCTGGACTGCATTGGAAACTGTCAGTCTTGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGTTTTTTAAGTATGAAGTGAAATCCCAGCTTTCAAGGTTGGGTCTGCTTTGTAGACTGGAAGACTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAAGCAAGTCTGAAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTTTAGCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCCCTGTAAGTCAGCGGTTAAATCGTGGAGCTCAACTCCATCCCGCCGTTGATACTGCAGGGCTTGATTGCGGTCGAGGTTGGCGGAATTCGCCGT0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGTTAAGTCAGCGGTGAAAGCGTGTAGCTCAACTATACCAAGCCGTTGAAACTGGCGTTCTTGAGTGTAAACGAGGTAGGCGGAATGTGACGT0.500000
d__BacteriaTACGTAGGTGGCGAGCGTTGTTCGGATTTATTGGGCGTAAAGGGTCCGTAGGAGGTTTTGCAAGTTCGACGTGAAATCCCGGAGCTCAACTCCGGAACTGCGTTGAAAACTGTGGAGCTAGAGTACTGGAGAGGTAAGCGGAATACCAGG0.500000
d__BacteriaTACAGAGGTCGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCATTGCGTGTCAAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTTGAAACTACAATGCTCGAGTCTGGGAGAGGGAATCGGAATGCAGGG0.500000
d__BacteriaTACAGAGGTCGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCATTGCGTGTCAGATGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGTCTGAAACTACAATGCTCGAGTCTGGGAGAGGGAATCGGAATATAGGG0.500000
d__BacteriaTACGGAAGGTCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAGATGCAAGCCAGCCGTAAAATCGTGGGGCTCAACCCCATTCAGCGGTTGGAACTTCATCCCTTGATTGCGGCAGAGGGAGGTGGAACTCGTGGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTATGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGGTGTGAAATCTATGGGCTTAACTCATAAACTGCACTTGAAACTGTGTCTCTTGAGTGCTGGAGAGGTAGATGGAATTCCTTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGGT0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTGGATCTTGAGTGCTGGAGGGGCAATCGGAATTCCTAG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGGATTAAGTGTGTTGTGAAATGTAGGCGCTCAACGTCTGACTTGCAGCGCATACTGGTCCACTAGAGTGCGCGCAACGCGGGCGGAATTTGTCG0.363636
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGATGCGTAGGCGGCCTCTTAAGTGGGATGTGAAATGCCGGGGCTTAACCCCGGAGGTGCATTCCATACTGGGAGGCTAGAGTGCAGGAGAGGAAAGCGGAATTCCCAG0.333333
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCAGCCTGTTAAGTCAGTGGTGAAAAGCTGTTGCTCAACGACAGTCGTGCCATTGATACTGATGGGCTTGAGTGTAAATGAAGTAGGCGGAATGTGCAG0.333333
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTTTCAAGTCTGGAGTGAAAGTCCCGGCTTCAAGTTGGGAATTGCTTTGGAAACTGGAGGGCTTGAGTGCAGGAGAGGTAAGTGGAATTCCCAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCGGCTTAAGCGCAGGGTATAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGTTGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAATGGCAAGTCTGATGTGAAAGCCCGGGGCTCATCCCCGGGACTGCATTGGAAACTGTCAATCTGGAGTGTCGGAAGGGCAAGCGGAATTCCTGG0.333333

Annotations:

common ontology terms
term enrichment score
TermScore
equine grass sickness0.600000
LOWER IN equine grass sickness0.333333
equus caballus0.200000
horse0.200000
united kingdom0.083333
farm0.054054
disease0.026549
LOWER IN disease0.025641
control0.010582
LOWER IN control0.010582
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
equine grass sickness0.500000
LOWER IN equine grass sickness0.500000
equus caballus0.111111
horse0.111111
united kingdom0.043478
farm0.027778
disease0.013514
LOWER IN disease0.013514
control0.005405
LOWER IN control0.005405
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
farm1.000000
equus caballus1.000000
horse1.000000
united kingdom1.000000
equine grass sickness0.750000
disease0.750000
control0.250000
LOWER IN equine grass sickness0.250000
LOWER IN disease0.250000
LOWER IN control0.250000

Problems / suggestions? Please email info AT dbbact DOT org