Summary for ontology term: equus caballus

Number of annotations with term: 56

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCGCTGCAAGTCAGATGTGAAACCCCGGGGCTTAACCCCGGGACTGCATTTGAAACTGCGGTGCTAGAGTG0.017857
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGAGCAGGCGGCTGTTTAAGTCTGAAGTCAAATCGTGGGGCTCAACCCCATCTCGCTTTGGAAACTGAACGGCTAGAGTAC0.017857
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTCCGCAGCCGGCTTATTAAGTATAGAATTAAAGCCCGAAGCTTAACTTCGGTTCGTTCTATAAACTGATAGGCTCGAGTGT0.017857
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGTGTAGGCGGGAAGGCAAGTCAGATGTGAAATTCATGGGCTTAACTTATGAAGTGCATTTGAAACTGTTTTTCTTGAGTA0.017857
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTGCGTCAAGTCAGAGGTGAAAGCCCGGAGCTCAACCCCGGAACTGCCTTTGATACTGACGTGCTGGAATA0.017857
d__BacteriaTACATATGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGCGGTTTGTTAAGTCGGTTGTGAAATACTGAGGCTAAGCCTCAGTCTGCATCCGAAACTGGCAGACTAGAGTAC0.017857
d__BacteriaTACAGAGGTCCCGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGTAAGGCGTGTCAAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTTGAAACTACCTTACTTTGAGT0.017857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGAACTGGGCGGCTCGAGTGC0.017857
d__BacteriaTACAGAGGCCAAGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCGAGTGTGTCAGATGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGTCTGAAACTGCTTGGCTCGAGTC0.017857
d__BacteriaTACAGAGGTCGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCAAAGCGTGTCAAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTTGAAACTACTTTGCTAGAGTC0.017857

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACATAGGTGGCAAGCGTTATCCGGAATAACTGGGCGTAAAGGGAGTGTAGGTGGCGTTGTAAGTTATATGTGAAAGACCATGGCTTAACCATGGAATTGCATATAAGACTGCAGTGCTAGAGTG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGTTAGGTCGGGAGTCAAATGCGGGGGCTCAACCCCCGCCCGCTCCCGATACCGGCGGGCTTGAGTCT0.500000
d__Bacteria;p__"Chloroflexi";c__Anaerolineae;o__Anaerolineales;f__AnaerolineaceaeAACGTAGGAGACGAGCGTTATCCGGATTTACTGGGCGTAAAGAGCGTGTAGGAGGCAGCGCAAGTTGGATGTGAAAGCTCCCGGCTTAACTGGGAGAAGTCGTTCAAAACTGCGCAGCTAGAGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGCTTTGCAAGTCAGATGTGAAATTCCTGAGCTCAACTCGGGCGCTGCATCTGAAACTGTAAAGCTTGAGTA0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGTTAAGTCAGTGGTGAAAGGTAGCTGCTCAACAGTTAAAGTGCCATTGATACTGGTAGACTAGAATT0.500000
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGTGTAGGCGGAGGATCAAGTCAGATGTGAAAATTATGGGCTCAACTCATAACTTGCATTTGAAACTGATCTCCTTGAGTG0.500000
d__BacteriaTACGGGGGGTGTAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGTGCAGGCGGTCACCGCAAGTTAAATGTGAAATCCCCGAGCTTAACTTGGGACGTGCGTTTAAGACTGCGGGACTAGAAT0.500000
d__ArchaeaTACCTGCAGCCCAAGTGGTGGTCGATTTTATTGAGTCTAAAACGTTCGTAGCCGGTTTGATAAATCCTTGGGTAAATCGGGAGGCTTAACTTTCCGACTTCCGGGGAGACTGTCAAACTTGGGAC0.500000
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGCAGGCGGTTTGTTTAGTCTGGGGTGAAAGCGTCGAGCTCAACTCGATTAAGCCTTGGATACTGGCAAACTAGAGTGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGAAGTGAAAGCCTGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTTAAGCTAGAGTG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCTTTTTAAGTCAGTGGTTAAATCGTGACGCTCAACGTCATCACGCCATTGATACTGGAGAGCTTGATTGCGGTCGAGGTTTGCGGAATTCGTTGT0.444444
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__ActinobacillusTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTGATTAAGTGAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTCATACTGGTCAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.394366
d__BacteriaTACAGAGGCCAAGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGTCTTGCGTGTCAAGTGTGAAATCTCCGGGCCCAACCCGGAAAGTGCGCTTGAAACTACAGGACTCGAGTCTGGGAGAGGGAATCGGAATGCAGGG0.382022
d__BacteriaTACAGAGGCCAAGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGTCTTGCGTGTCAAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTTGAAACTACAGGACTCGAGTCTGGGAGAGGGAATCGGAATATAGGG0.380000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XIII;g__MogibacteriumTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCGCAAGGTTTAATCTTGAGGCTTAACCTCATTCTGCCTTGCGAACTGGGCTACTTGAGTGCAGGAGGGGAAAGCGGAATTCCTAGT0.379747
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCATGTTAAGTCAGCGGTTAAATAGTGAGGCTCAACCTCATCCCGCCGTTGATACTGGCACGCTTGATTTCGGTTGAGGTTGGCGGAATTCGCCGT0.379747
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCTGTTTTTATTGGGCCTAAAGCGTTCGTAGCCGGTTTAATAAGTCACTGGTGAAATCCTGTAGCTTAACTGTGGGAATTGCTGGTGATACTGTTGAACTTGAGGTCGGGAGAGGTTAGCGGTACTCCCA0.375000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGCTTTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGGAGCACTTGAGTACGCAGGAAGTAGGCGGAATTCGTCG0.373333
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTGCCAAGTCAGCGGTGAAATCCGGGCGCCCAACGCCGGAACTGCCGTTGAAACTGGCGGGCTTGAATGGTGCCGCCGCATGCGGAATGTGTGA0.366197
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTGCTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTTTGGATACTGGGCAGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.363636

Annotations:

common ontology terms
term enrichment score
TermScore
equus caballus0.944206
horse0.869888
barn0.222222
hay0.200000
farm0.177778
adult organism0.171429
pasture0.162162
state of texas0.133333
edinburgh0.125000
canada0.110429
nasal cavity0.105263
antibiotics induced colitis0.096774
equine grass sickness0.096774
scotland0.095238
salmonella gastroenteritis0.092308
pair of nares0.090909
salmonellosis0.088235
oral cavity0.086957
cecal content0.077922
antibiotic0.068493
LOWER IN barn0.066667
caudal teeth0.066667
LOWER IN rostral teeth0.066667
guanzhong horse0.066667
LOWER IN hay0.064516
LOWER IN pasture0.064516
mouth0.064057
shanxi province0.062500
colitis0.061856
united kingdom0.060000
state of north carolina0.058824
dentition0.054054
italy0.040000
LOWER IN colitis0.039216
feces0.039145
saliva0.037578
control0.037229
LOWER IN asthma0.034483
asthma0.034483
LOWER IN antibiotics induced colitis0.034483
LOWER IN equine grass sickness0.034483
LOWER IN control0.034072
LOWER IN salmonella gastroenteritis0.033898
LOWER IN salmonellosis0.033333
equus przewalskii0.033333
LOWER IN equus przewalskii0.033333
caecum0.032967
skin0.032258
LOWER IN cecal content0.031746
metronidazole0.031746
LOWER IN metronidazole0.031746
LOWER IN nasal cavity0.029851
LOWER IN equus caballus0.029851
united states of america0.029720
LOWER IN pair of nares0.028571
LOWER IN oral cavity0.028169
LOWER IN antibiotic0.027027
LOWER IN mouth0.024691
research facility0.023095
LOWER IN caecum0.020408
LOWER IN saliva0.019417
adult0.010363
china0.009390
disease0.008559
LOWER IN disease0.007380
LOWER IN feces0.004988
Fraction of dbbact annotations with this term covered by the query
TermScore
equus caballus0.909091
horse0.818182
LOWER IN barn0.500000
barn0.500000
LOWER IN asthma0.500000
asthma0.500000
LOWER IN antibiotics induced colitis0.500000
antibiotics induced colitis0.500000
LOWER IN equine grass sickness0.500000
equine grass sickness0.500000
edinburgh0.500000
caudal teeth0.500000
LOWER IN rostral teeth0.500000
guanzhong horse0.500000
pasture0.333333
LOWER IN hay0.333333
hay0.333333
LOWER IN pasture0.333333
LOWER IN salmonella gastroenteritis0.333333
salmonella gastroenteritis0.333333
LOWER IN salmonellosis0.250000
equus przewalskii0.250000
LOWER IN equus przewalskii0.250000
salmonellosis0.250000
shanxi province0.250000
state of north carolina0.166667
LOWER IN cecal content0.142857
cecal content0.142857
metronidazole0.142857
LOWER IN metronidazole0.142857
adult organism0.142857
scotland0.142857
state of texas0.125000
farm0.108108
nasal cavity0.090909
LOWER IN nasal cavity0.090909
LOWER IN equus caballus0.090909
pair of nares0.071429
LOWER IN pair of nares0.071429
canada0.066667
oral cavity0.066667
LOWER IN oral cavity0.066667
LOWER IN antibiotic0.055556
antibiotic0.055556
italy0.045455
LOWER IN colitis0.043478
colitis0.043478
dentition0.043478
united kingdom0.041667
mouth0.040000
LOWER IN mouth0.040000
skin0.029412
LOWER IN caecum0.023810
caecum0.023810
saliva0.021277
LOWER IN saliva0.021277
control0.021053
LOWER IN control0.021053
feces0.020290
united states of america0.015444
research facility0.012346
china0.005405
adult0.005376
LOWER IN disease0.004651
disease0.004651
LOWER IN feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
equus caballus0.982143
horse0.928571
feces0.553571
farm0.500000
united states of america0.392857
canada0.321429
adult organism0.214286
research facility0.178571
saliva0.160714
mouth0.160714
control0.160714
barn0.142857
hay0.142857
adult0.142857
state of texas0.142857
nasal cavity0.125000
pair of nares0.125000
oral cavity0.125000
pasture0.107143
colitis0.107143
united kingdom0.107143
LOWER IN control0.089286
antibiotic0.089286
dentition0.071429
edinburgh0.071429
scotland0.071429
caecum0.053571
cecal content0.053571
antibiotics induced colitis0.053571
salmonellosis0.053571
salmonella gastroenteritis0.053571
equine grass sickness0.053571
disease0.053571
LOWER IN barn0.035714
LOWER IN hay0.035714
LOWER IN pasture0.035714
italy0.035714
skin0.035714
LOWER IN colitis0.035714
state of north carolina0.035714
caudal teeth0.035714
LOWER IN rostral teeth0.035714
guanzhong horse0.035714
shanxi province0.035714
china0.035714
LOWER IN pair of nares0.017857
LOWER IN nasal cavity0.017857
LOWER IN oral cavity0.017857
LOWER IN saliva0.017857
LOWER IN mouth0.017857
LOWER IN asthma0.017857
LOWER IN caecum0.017857
LOWER IN cecal content0.017857
LOWER IN feces0.017857
metronidazole0.017857
LOWER IN metronidazole0.017857
asthma0.017857
LOWER IN antibiotics induced colitis0.017857
LOWER IN antibiotic0.017857
LOWER IN salmonellosis0.017857
LOWER IN salmonella gastroenteritis0.017857
equus przewalskii0.017857
LOWER IN equus caballus0.017857
LOWER IN equus przewalskii0.017857
LOWER IN equine grass sickness0.017857
LOWER IN disease0.017857
Exp. ID User ID Description Date Region Flag Sequences
384amnon high in asthma compared to control in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 1
599amnon high in caudal teeth compared to rostral teeth in equus caballus horse dentition edinburgh scotland farm 2020-03-25v4No1 / 1
702amnondominant equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 2
902amnondominant adult organism, horse, equus caballus, united states of america, control, feces2022-05-02v4No1 / 3
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 4
448amnonhigh freq. in healthy horse feces (dominant equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v4No1 / 5
384amnon high in control compared to asthma in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 6
632amnondominant caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 7
565amnondominant skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 7
18amnondominant feces, united states of america, equus caballus2016-11-09v4No1 / 7
599amnon high in caudal teeth compared to rostral teeth in equus caballus horse dentition edinburgh scotland farm 2020-03-25v4No1 / 8
632amnondominant feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 10
666amnondominant horse, equus caballus, italy, feces2020-09-25v3No1 / 10
384amnondominant equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 11
902amnondominant salmonellosis, adult organism, horse, equus caballus, salmonella gastroenteritis, antibiotic, united states of america, feces2022-05-02v4No1 / 13
384amnondominant equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 14
384amnondominant equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 15
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v4No1 / 16
448amnondominant equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
384amnondominant equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 18
599amnoncommon equus caballus, horse, dentition, edinburgh, scotland, farm2020-03-25v4No1 / 19
599amnondominant equus caballus, horse, dentition, edinburgh, scotland, farm2020-03-25v4No1 / 19
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
702amnoncommon equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 207
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 341
902amnoncommon control, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 350
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
448amnoncommon in healthy horse feces (common equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v4No1 / 508
908amnoncommon guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 567
384amnon high in oral cavity saliva mouth compared to pair of nares nasal cavity in equus caballus horse canada farm 2018-10-22v4No1 / 604
902amnon high in control compared to salmonellosis salmonella gastroenteritis in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 679
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 698
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
632amnoncommon feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 848
632amnon high in feces compared to caecum cecal content in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 897
632amnoncommon caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 914
632amnon high in caecum cecal content compared to feces in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 943
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
448amnon high in control compared to equine grass sickness disease in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 1084
18amnon high in equus przewalskii compared to equus caballus in feces 2016-11-14v4No1 / 1542
902amnon high in control compared to antibiotics induced colitis antibiotic colitis colitis in adult organism united states of america feces horse equus caballus 2022-05-02v4No1 / 1755
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800

Problems / suggestions? Please email info AT dbbact DOT org