Summary for ontology term: estonia

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCGTACTTGAGTATCGGAGAGGTAAGTGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTCTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGGG0.181818
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGCTCGATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTCGAGCTTGAGTACAGAAGAGGAGAGTGGAACTCCATG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTCTGCAAGTTGGAAGTGAAACCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGCGGATCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.181818
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGATAGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATATATGACTGCAAGACTTGAGTTTGTCAGAGGAGGGTGGAATTCCAAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGGATTCCGTG0.181818

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__EubacteriumTACGTAGGGGACAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTCTATTAAGTCTGATGTGAAAGGTACCGGCTCAACCGGTGAAGTGCATTGGAAACTGGTAGACTTGAGTATTGGAGAGGCAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACGGGCAAGTCTGATGTGAAAGCCCGGGGCTTAACCCCGGGACTGCATTGGAAACTGTCCATCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGCAGCTAGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCATGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACGAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__FirmicutesTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGGATTCCGTG0.266667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGGAAGTGAAATGCATGGGCTTAACCCATGAGCTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGGATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGTAAGTTGGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGGATTCCGTG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGATGAAGTATTTCGGTATGTAAAACTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.230769
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATAAGGGAATAAAGTTAGTCTCGTGAGACTTTTTGCATGTACCTTATGAATAAGGACCGGCTAATT0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__ParaprevotellaTGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTAGCGTGAAGGACGACGGCCCTACGGGTTGTAAACTTCTTTTATAAGGGAATAAAGTTCGCCACGTGTGGTGTTTTGTATGTACCTTATGAATAAGCATCGGCTAATT0.181818
d__Bacteria;p__"Lentisphaerae";c__"Lentisphaeria";o__Victivallales;f__"Victivallaceae";g__VictivallisTCGAGAATCTTGGGCAATGCGCGAAAGCGTGACCCAGCAATGCCGCGTGTGTGATGAAGGCCTTCGGGTCGTAAAGCACTGTCTCCCGTGACGAAATTTGACGGTAGCGGGGAAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT0.181818
d__BacteriaTGGGGAATATTGGGCAATGGAGGGAACTCTGACCCAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATTGTAAAACTCTTTAAGCGGGGACGAAGAAAGTGACTGTACCCGCAGAATAAGCATCGGCTAACTACGTGCCAGCAGCCGCG0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGCGGGACGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGAATATAGTGAAGGTACCTGCAGAAGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.173913

Annotations:

common ontology terms
term enrichment score
TermScore
estonia0.740741
age < 3 years0.400000
obesity0.222222
ketogenic diet0.222222
LOWER IN estonia0.222222
high bmi0.133333
LOWER IN ketogenic diet0.117647
LOWER IN finland0.105263
finland0.105263
russia0.090909
LOWER IN russia0.090909
control diet0.076923
LOWER IN control diet0.076923
infant0.071429
homo sapiens0.014652
feces0.012658
adult0.011429
Fraction of dbbact annotations with this term covered by the query
TermScore
estonia0.666667
LOWER IN estonia0.333333
age < 3 years0.333333
LOWER IN ketogenic diet0.200000
ketogenic diet0.200000
LOWER IN finland0.142857
finland0.142857
obesity0.142857
russia0.100000
LOWER IN russia0.100000
high bmi0.076923
control diet0.071429
LOWER IN control diet0.071429
infant0.038462
homo sapiens0.007380
feces0.006369
adult0.005780
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
estonia0.833333
infant0.500000
age < 3 years0.500000
obesity0.500000
adult0.500000
high bmi0.500000
ketogenic diet0.250000
LOWER IN estonia0.166667
russia0.083333
LOWER IN russia0.083333
LOWER IN finland0.083333
finland0.083333
control diet0.083333
LOWER IN ketogenic diet0.083333
LOWER IN control diet0.083333
Exp. ID User ID Description Date Region Flag Sequences
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169

Problems / suggestions? Please email info AT dbbact DOT org