Summary for ontology term: euarchontoglires

Number of annotations with term: 2532

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.002744
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCCGGGCTTAACCCGGGAACTGCTTTGGAAACTGTACGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.002744
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.002352
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.002352
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.001960
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.001960
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGCCGGGCAAGTCCGCAGTAAAAACTGGAGGCTCAACCTTCAGGGGCTGCGGAAACTGTCCGGCTGGAGAGCAGGAGAGGACGGTGGAACTCCATGT0.001960
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTTACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTAGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.001960
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.001960
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.001960

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGGAGTGAAAGGCAGGGGCCCAACCCCTGGACTGCTCTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATTCCGGGGCTCAACCCCGGACCTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCTGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.111111
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAATGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCGCAGGCTCAACCTGCGAACTGCATTTGAAACTGTTTCCCTTGAGTATCGGAGAGGTCATCGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGAGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.111111

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.294730
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.286624
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.285161
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.277104
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.268874
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.265869
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.257826
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.257769
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.255166
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.252688

Annotations:

common ontology terms
term enrichment score
TermScore
homo sapiens0.832039
feces0.660711
adult0.515244
united states of america0.396015
research facility0.302871
mus musculus0.280475
mouse0.263390
child0.186599
control0.181734
saliva0.161307
female0.158932
china0.151946
infant0.142663
LOWER IN control0.121846
c57bl/60.100525
male0.081990
dentition0.079163
germany0.065734
caecum0.064683
canada0.064240
mouth0.063709
skin0.062754
monkey0.062031
rat0.060285
kingdom of spain0.060123
subgingival plaque0.058161
human adult stage0.054521
supragingival plaque0.052422
oral cavity0.050611
australia0.050081
state of new york0.050014
sweden0.048744
rural community0.048457
macaca mulatta0.047613
city0.045566
supragingival dental plaque0.044899
state of california0.044248
wild0.042534
rattus norvegicus0.041417
c57bl/6j0.040922
south korea0.038526
sprague dawley0.037209
obsolete_juvenile stage0.035528
italy0.034938
mouth mucosa0.034773
obesity0.034113
captive0.033746
kingdom of the netherlands0.033067
zoological garden0.031299
high fat diet0.031104
periodontitis0.031064
israel0.030569
japan0.029829
mouse chow0.029463
nasopharynx0.029386
vagina0.028650
czech republic0.027804
oryctolagus cuniculus0.027269
jackson laboratories0.027207
age0.026326
province of ontario0.026154
brazil0.026026
diet0.025289
tongue0.024917
colon0.024562
formula fed0.024190
balb/c0.023380
amsterdam0.023351
biopsy0.022611
crohn's disease0.022605
commonwealth of pennsylvania0.022538
pregnancy0.022534
1-month-old human stage0.021875
2-year-old human stage0.021875
3-month-old human stage0.021835
subgingival dental plaque0.021827
ulcerative colitis0.021803
hispanic or latin american0.021796
puerto rico0.021638
africa0.021186
homosexual0.021058
msm0.021058
1-year-old human stage0.020925
united kingdom0.020741
oral wash0.020294
hunter gatherer0.020277
india0.020260
breast fed0.020260
hospital0.020192
stomach0.020185
age 8 weeks0.019727
12-month-old human stage0.019554
high bmi0.019539
hiv infection0.019533
antibiotic0.019433
nasal cavity0.019396
fourth decade human stage0.018754
state of texas0.018674
rhesus macaque0.018605
tanzania0.017963
Fraction of dbbact annotations with this term covered by the query
TermScore
supragingival dental plaque1.125000
supragingival plaque1.090909
homo sapiens1.020761
mus musculus1.000000
oryctolagus cuniculus1.000000
c57bl/61.000000
1-month-old human stage1.000000
high fat diet1.000000
sprague dawley1.000000
12-month-old human stage1.000000
formula fed1.000000
LOWER IN breast fed1.000000
2-year-old human stage1.000000
state of oklahoma1.000000
6-month-old human stage1.000000
2-month-old human stage1.000000
rabbit1.000000
papio anubis1.000000
olive baboon1.000000
third trimester1.000000
non-pregnant1.000000
LOWER IN non-pregnant1.000000
18-month-old human stage1.000000
cigarette smoking1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
antimicrobial agent1.000000
antibiotics supllemented diet1.000000
LOWER IN antibiotics supllemented diet1.000000
ad libitum diet1.000000
LOWER IN farm21.000000
farm11.000000
LOWER IN farm11.000000
farm21.000000
9-month-old human stage1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
no dental caries1.000000
interproximal dental plaque1.000000
lingual dental plaque1.000000
vestibular dental plaque1.000000
LOWER IN interproximal dental plaque1.000000
LOWER IN lingual dental plaque1.000000
orenburg1.000000
age 4-7 years1.000000
mouse0.983607
infant0.966667
saliva0.957447
child0.948718
subgingival plaque0.933333
high bmi0.928571
obesity0.923077
periodontitis0.923077
rural community0.923077
LOWER IN high fat diet0.916667
c57bl/6j0.909091
hiv infection0.900000
adult0.892473
LOWER IN low bmi0.888889
low bmi0.888889
rat0.888889
LOWER IN iga positive fraction0.888889
iga negative fraction0.888889
LOWER IN iga negative fraction0.888889
iga positive fraction0.888889
tongue0.875000
biopsy0.875000
balb/c0.875000
fourth decade human stage0.875000
LOWER IN 2-year-old human stage0.875000
dentition0.869565
LOWER IN mouse chow0.866667
oral cavity0.866667
control diet0.866667
LOWER IN control diet0.866667
crohn's disease0.857143
3-month-old human stage0.857143
jackson laboratories0.857143
oral wash0.857143
macaca mulatta0.857143
female0.848485
homosexual0.833333
msm0.833333
gorilla gorilla0.833333
subgingival dental plaque0.833333
mouth0.800000
LOWER IN hiv infection0.800000
sputum0.800000
lung0.800000
bronchial epithelium0.800000
tanzania0.800000
LOWER IN normal diet0.800000
obsolete_juvenile stage0.800000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.702212
feces0.593602
adult0.362164
united states of america0.322275
research facility0.212875
mus musculus0.163112
mouse0.152054
china0.109400
control0.104660
child0.103476
saliva0.088073
female0.087678
infant0.077014
LOWER IN control0.067141
c57bl/60.052923
male0.043444
dentition0.041469
germany0.036730
canada0.035545
caecum0.035150
skin0.033965
mouth0.033175
monkey0.032385
kingdom of spain0.031596
rat0.031201
subgingival plaque0.030016
human adult stage0.029226
australia0.026856
supragingival plaque0.026856
sweden0.026066
oral cavity0.026066
state of new york0.026066
rural community0.024882
macaca mulatta0.024487
state of california0.023697
city0.023697
supragingival dental plaque0.022907
wild0.022512
rattus norvegicus0.021327
c57bl/6j0.020932
south korea0.019747
sprague dawley0.018957
obsolete_juvenile stage0.018167
italy0.018167
mouth mucosa0.017773
captive0.017773
obesity0.017378
kingdom of the netherlands0.016983
zoological garden0.016193
periodontitis0.015798
high fat diet0.015798
israel0.015798
japan0.015403
nasopharynx0.015008
mouse chow0.015008
vagina0.014613
czech republic0.014218
oryctolagus cuniculus0.013823
jackson laboratories0.013823
age0.013428
brazil0.013428
province of ontario0.013428
diet0.013033
tongue0.012638
colon0.012638
formula fed0.012243
balb/c0.011848
amsterdam0.011848
africa0.011848
pregnancy0.011453
biopsy0.011453
crohn's disease0.011453
commonwealth of pennsylvania0.011453
3-month-old human stage0.011058
1-month-old human stage0.011058
united kingdom0.011058
2-year-old human stage0.011058
ulcerative colitis0.011058
puerto rico0.011058
hispanic or latin american0.011058
subgingival dental plaque0.011058
1-year-old human stage0.010664
homosexual0.010664
msm0.010664
stomach0.010269
hospital0.010269
india0.010269
hunter gatherer0.010269
oral wash0.010269
age 8 weeks0.010269
breast fed0.010269
hiv infection0.009874
antibiotic0.009874
high bmi0.009874
nasal cavity0.009874
12-month-old human stage0.009874
state of texas0.009479
fourth decade human stage0.009479
rhesus macaque0.009479
tanzania0.009084
Exp. ID User ID Description Date Region Flag Sequences
14amnonhighest in the right colon ( high in right colon compared to caecum in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
14amnonhighest in feces compared to colon ( high in feces compared to colon in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
14amnonmuch higher in right and transverse colon compared to other GI tract ( high in right colon transverse colon compared to left colon caecum in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
23amnonhuman DNA (other homo sapiens, feces, united states of america)2016-11-29v4No1 / 1
31amnonHuman mitochondrial DNA (other homo sapiens)2016-12-05v4No1 / 1
31amnonHuman mitochondrial DNA (other homo sapiens)2016-12-06v4No1 / 1
31amnonHuman DNA (other homo sapiens)2016-12-06v4No1 / 1
55amnonhuman DNA (other homo sapiens)2017-01-26v4No1 / 1
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 1
80amnonHigher in fruit season compared to leaf season ( high in season fruit season compared to leaf season in feces central america alouatta pigra howler monkey state of florida )2017-03-03v4No1 / 1
121amnoncausitive agent for acute diarrhea (other pathogen, homo sapiens, feces, bangladesh, diarrhea)2017-04-13v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v4No1 / 1
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v4No1 / 1
131amnonpositively correlated with age (30-80 years) ( high in human late adulthood stage age compared to fifth decade human stage fourth decade human stage in homo sapiens feces south korea )2017-04-16v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
228amnonhigh in sinus brush of CF patients compared to other sinusitis ( high in cystic fibrosis compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 1
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v4No1 / 1
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v4No1 / 1
230amnonmouse genome dna (other mouse, mus musculus, dna)2017-11-02v4No1 / 1
230amnondominant mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 1
335amnonTropheryma whipplei (other homo sapiens, bronchial epithelium, pathogen, whipple disease, whipple's disease)2018-05-16v4No1 / 1
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 1
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 1
434amnon high in control diet compared to fructose diet fructose in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v4No1 / 1
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in plant fiber cell high fiber high arabinoxylan and resistant starch diet compared to control diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 1
553amnonhuman mitochondrial DNA (other homo sapiens, mitochondrion)2019-09-10v4No1 / 1
553amnonhuman DNA (other homo sapiens)2019-09-10v4No1 / 1
569amnonHelicobacter pylori pathogen (other homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori, pathogen, helicobacter pylori infectious disease)2019-12-16v3No1 / 1
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 1
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v3No1 / 1
606amnonnegatively correlated with age in human penis skin ( high in young age compared to old age in penis skin adult south africa homo sapiens male organism male )2020-04-15v3No1 / 1
607amnon high in control compared to parkinson's disease in germany nasopharynx homo sapiens nasal wash 2020-04-19v4No1 / 1
666amnondominant rattus rattus, rat, italy, feces2020-09-25v3No1 / 1
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v3No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 1
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 1
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 1
806amnon high in cigarette smoking nicotine dependence smoker compared to non-smoker in mouth mucosa buccal mucosa homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 1
919amnon high in breast fed compared to formula fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
102amnon high in hiv infection compared to control in homo sapiens atlanta united states of america cheek mouth 2017-04-04v4No1 / 2
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 2
203amnonhigher in kids with frequent toothbrushing ( high in toothbrushing frequent brushing compared to infrequent brushing in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 2
227amnonpeaks at age 1 month in baby nasopharynx ( high in 1-month-old human stage age compared to infant stage newborn human stage in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 2
227amnonpeaks at age 3 months in baby nasopharynx ( high in 3-month-old human stage age compared to infant stage age > 3 months age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 2
227amnonlower in infants with respiratory illness compared to healthy controls ( high in control compared to respiratory system disease in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v4No1 / 2
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
239amnon high in control compared to colorectal adenocarcinoma colorectal cancer carcinoma in homo sapiens feces united states of america 2017-11-08v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
344amnon high in control compared to hiv infection in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 2
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
455amnonColonizes gut as well as saliva (other homo sapiens, saliva, feces)2019-11-25v4No1 / 2
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens russia adult 2020-01-05v3No1 / 2
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 2
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 2
850amnoncommon in vitro fertilization clinic, adult, anambra state, nigeria, female organism, vagina, homo sapiens2021-12-16v4No1 / 2
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v3No1 / 2
877amnon high in low breath methane content compared to high breath methane content in human early adulthood stage adult homo sapiens feces austria 2022-03-08v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
80amnonHigher in leaf season compared to fruit season ( high in season leaf compared to botanical fruit food product in feces central america alouatta pigra howler monkey state of florida )2017-03-03v4No1 / 3
104amnon high in control compared to periodontitis in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
203amnon high in male compared to female in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth 2017-10-01v4No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 3
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 3
593amnon high in osteoarthritis compared to rheumatoid arthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 3
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 3
607amnon high in parkinson's disease rem sleep behavior disorder compared to control in germany homo sapiens feces 2020-04-19v4No1 / 3
689amnon high in clostridium difficile infection clostridium difficile colitis compared to non c. diff diarrhea in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v3No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v4No1 / 3
806amnon high in buccal mucosa mouth mucosa compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 3
833amnon high in athlete high exercise compared to normal exercise in homo sapiens feces age 60-65 years slovak republic adult 2021-09-11v1No1 / 3
919amnon high in formula fed compared to breast fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 3
925amnon high in lingual dental plaque compared to interproximal dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v3No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
102amnon high in hiv infection compared to control in homo sapiens atlanta united states of america dentition mouth 2017-04-04v4No1 / 4
203amnon high in female compared to male in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth 2017-10-01v4No1 / 4
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
260amnonhigher in natiral tooth compared to dental implant ( high in natural tooth compared to implant in homo sapiens dentition subgingival plaque united states of america state of nebraska mouth )2017-12-05v4No1 / 4
285amnonlower in individuals with muc5ac ( high in muc5ac deficient compared to muc5ac in homo sapiens child obsolete_juvenile stage middle ear acute transudative otitis media united states of america state of washington )2018-01-27v4No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 4
570amnon high in visceral leishmaniasis compared to control in homo sapiens feces india bihar state 2019-12-16v3No1 / 4
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 4
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in germany homo sapiens feces 2020-04-19v4No1 / 4
655amnon high in before hsct compared to hematopoietic stem cell transplant after hcst in italy feces homo sapiens 2020-09-13v3No1 / 4
685amnon high in control compared to helicobacter pylori infectious disease in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 4
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 4
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v4No1 / 4
716amnon high in chronic bad breath halitosis compared to control in tongue china dermal layer of tongue homo sapiens adult 2028-05-22v3No1 / 4
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 4
850amnoncommon sperm, semen, male organism, in vitro fertilization clinic, anambra state, nigeria, adult, homo sapiens2021-12-16v4No1 / 4
923amnondominant japan, rat, sprague dawley, rattus norvegicus, oral cavity, research facility2022-07-27v3No1 / 4
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 5
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
96amnon high in control compared to systemic lupus erythematosus in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 5
104amnon high in periodontitis compared to control in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 5
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in homo sapiens feces united states of america )2017-10-23v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 5
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in 2-month-old human stage homo sapiens infant vellore district city india )2018-05-14v4No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 5
528amnoncommon homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 5
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 5
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 5
598amnon high in male compared to female in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
598amnon high in female compared to male in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
607amnon high in parkinson's disease compared to control in germany nasopharynx homo sapiens nasal wash 2020-04-19v4No1 / 5
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 5
685amnon high in evening compared to morning in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 5
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to buccal mucosa mouth mucosa in adult state of michigan united states of america homo sapiens )2021-01-09v4No1 / 5
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 5
794amnon high in antiretroviral therapy human immunodeficiency virus infectious disease hiv infection compared to control in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 5
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v3No1 / 5
806amnon high in hard palate compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 5
831amnon high in control compared to pancreatic cancer in israel adult feces homo sapiens 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 5
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 5
925amnon high in interproximal dental plaque compared to lingual dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v3No1 / 5
26amnon high in inguinal region axilla compared to pair of nares mucus in united states of america homo sapiens 2016-12-05v4No1 / 6
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
63amnon high in diet plant based diet compared to animal product diet in homo sapiens united states of america feces 2017-04-12v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens mouth mucosa oral cavity mouth china 2017-10-01v4No1 / 6
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in newborn human stage age age 24 hours compared to newborn human stage age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 6
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v4No1 / 6
239amnon high in colorectal adenocarcinoma colorectal cancer carcinoma compared to control in homo sapiens feces united states of america 2017-11-08v4No1 / 6
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 6
344amnon high in hiv infection compared to control in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 6
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 6
423amnon high in female compared to male in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 6
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 6
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
773amnon high in recurrent tonsillitis tonsillitis compared to iga glomerulonephritis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v4No1 / 6
919amnondominant 2-month-old human stage, 1-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 6
52amnoncommon homo sapiens, skin, nipple, state of california2017-01-19v4No1 / 7
102amnon high in control compared to periodontitis in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 7
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 7
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
277amnon high in nasopharynx compared to nasal cavity pair of nares in homo sapiens belgium adult 2018-01-23v4No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 7
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
535amnoncommon in healthy adult vaginal samples (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
644amnonpositively correalted with bmi ( high in high bmi body mass index compared to low bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 7
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 7
663amnondominant lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 7
679amnondominant saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 7
685amnon high in helicobacter pylori infectious disease compared to control in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 7
717amnondominant dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 7
730amnon high in crohn's disease compared to control in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 7
734amnon high in vegetarian diet compared to omnivore diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 7
806amnon high in oral wash oral cavity compared to saliva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
833amnon high in normal exercise compared to athlete high exercise in adult slovak republic age 60-65 years feces homo sapiens 2021-09-11v1No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in human adult stage state of texas adult saliva united states of america homo sapiens 2021-11-08v4No1 / 7
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v4No1 / 7
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 7
892amnon high in 4-year-old human stage compared to 2-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 7
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 7
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
17amnondominant ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 8
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 8
230amnoncommon mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 8
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, australia, foot)2017-11-05v4No1 / 8
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 8
274amnondominant monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
332amnoncommon 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v4No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
592amnondominant united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 8
594amnondominant adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 8
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 8
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
666amnoncommon european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 8
717amnondominant upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 8
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
777amnondominant 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 8
819amnondominant dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 8
859amnon high in 1-month-old human stage compared to 6-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 8
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 8
906amnon high in male organism compared to female organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 8
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 9
80amnondominant feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 9
163amnondominant ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 9
227amnoncommon in baby nasopharynx age 1 day to 3 months (common 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
332amnondominant 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v4No1 / 9
423amnondominant bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 9
535amnon high in dysplasia of cervix compared to control in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 9
569amnonhigh freq. in gastric biopsies of patients negative for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
607amnonhigher in blanks compared to nasopharyngeal samples (contamination)2020-04-19v4No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in amsterdam kingdom of the netherlands adult homosexual msm feces homo sapiens 2020-05-31v4No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 9
658amnon high in european caucasian compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 9
678amnon high in tooth disease black dental staining compared to control in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 9
711amnondominant age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 9
773amnonhigh in non iga bound bacteria compared to iga bound bacteria ( high in iga negative fraction compared to iga positive fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
773amnonhigh in iga bound bacteria compared to non iga bound bacteria ( high in iga positive fraction compared to iga negative fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 9
819amnondominant adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 9
819amnondominant skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 9
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in province of alberta canada adult homo sapiens feces )2022-02-12v4No1 / 9
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 9
906amnondominant grey squirrel, sciurus carolinensis, province of ontario, canada, feces2022-05-19v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 10
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common 12-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant 12-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
279amnondominant pika, ochotonidae, colon, caecum, china2018-01-24v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 10
354amnondominant homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
411amnondominant zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v3No1 / 10
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 10
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 10
711amnondominant adult, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 10
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 10
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 10
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in canada province of alberta adult feces homo sapiens )2022-02-12v4No1 / 10
916amnondominant rabbit, age 2 months, kingdom of spain, oryctolagus cuniculus, caecum, research facility2022-07-04v4No1 / 10
919amnoncommon saliva, 2-month-old human stage, 1-month-old human stage, infant, state of victoria, australia, homo sapiens2022-07-17v4No1 / 10
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v4No1 / 11
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 11
96amnon high in systemic lupus erythematosus compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 11
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 11
191amnondominant homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 11
202amnon high in mouth neoplasm neoplasm cancer compared to control in homo sapiens mouth mucosa china mouth oral cavity 2017-10-01v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 11
264amnondominant oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 11
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 11
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
371amnondominant feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
399amnondominant feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 11
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
533amnoncommon 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 11
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 11
592amnondominant wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v1No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to teeth braces braces in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 11
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 11
717amnondominant chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
717amnondominant plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
729amnondominant europe, zoological garden, feces, monkey, gorilla gorilla2021-01-05v3No1 / 11
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 11
806amnon high in palatine tonsil compared to oral wash oral cavity in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 11
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in age 25-45 years china scalp adult skin female homo sapiens 2021-07-12v1No1 / 11
819amnondominant dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 11
848amnoncommon 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 11
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 11
919amnondominant state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 11
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v4No1 / 12
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 12
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 12
163amnondominant stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v4No1 / 12
279amnondominant pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 12
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 12
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 12
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 12
533amnondominant 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v4No1 / 12
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
556amnondominant homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 12
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 12
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 12
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
592amnondominant wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v1No1 / 12
596amnondominant 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 12
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 12
684amnondominant middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 12
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
717amnondominant palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 12
717amnondominant external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 12
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
773amnon high in iga glomerulonephritis compared to recurrent tonsillitis tonsillitis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 12
777amnondominant 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 12
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 12
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 12
797amnoncommon breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 12
806amnondominant gingiva, keratinized gingiva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 12
817amnondominant bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 12
873amnondominant urban community, human adult stage, commonwealth of pennsylvania, adult, united states of america, homo sapiens, feces2022-03-03v1No1 / 12
906amnon high in female organism compared to male organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
935amnondominant monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v4No1 / 12
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v4No1 / 13
108amnon high in colon compared to caecum in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 13
187amnondominant rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
232amnonhigher in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in ulcer wound compared to control in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 13
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 13
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 13
611amnon high in male compared to female in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 13
620amnondominant village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 13
625amnondominant gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 13
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 13
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 13
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 13
710amnondominant mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 13
713amnon high in remission compared to active disease in crohn's disease feces homo sapiens 2028-05-21v3No1 / 13
717amnondominant armpit, axilla, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 13
725amnondominant control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 13
731amnondominant buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 13
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 13
806amnondominant oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 13
833amnondominant high exercise, athlete, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 13
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
861amnondominant urban community, soweto, rural community, south africa, city, female, homo sapiens, feces2022-01-15v3No1 / 13
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v4No1 / 13
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 14
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
80amnondominant feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
186amnondominant rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 14
190amnondominant homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnondominant homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
399amnondominant feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
546amnondominant homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 14
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 14
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 14
596amnondominant 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
596amnondominant 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
598amnonprobable contaminant (collection date dependent) (contamination)2020-03-25v3No1 / 14
625amnondominant son tra nature reserve, viet nam, pygathrix nemaeus, red-shanked douc, wild, feces2020-05-16v4No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
666amnondominant italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 14
666amnondominant rattus rattus, rat, italy, feces2020-09-25v3No1 / 14
684amnoncommon middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 14
693amnondominant graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
734amnon high in omnivore diet compared to vegetarian diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 14
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
770amnondominant male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
770amnondominant vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 14
797amnondominant breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 14
831amnondominant israel, adult, feces, homo sapiens, pancreatic cancer2021-09-11v3No1 / 14
834amnondominant homo sapiens, feces, japan, adult2021-09-11v1No1 / 14
850amnondominant in vitro fertilization clinic, anambra state, female organism, nigeria, adult, vagina, homo sapiens2021-12-16v4No1 / 14
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v1No1 / 14
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v4No1 / 14
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 14
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 14
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 14
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
25amnon high in compared to in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
74amnondominant united states of america, feces, homo sapiens2017-02-27v4No1 / 15
75amnondominant homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
102amnon high in control compared to hiv infection in homo sapiens atlanta united states of america cheek mouth 2017-04-04v4No1 / 15
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 15
227amnonhigher in age > 3 months in baby nasopharynx ( high in infant stage age age > 3 months compared to age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
279amnondominant pika, ochotonidae, mouth, china2018-01-24v4No1 / 15
300amnondominant rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 15
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
335amnondominant homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
358amnondominant rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
380amnondominant tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v4No1 / 15
409amnondominant homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 15
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
517amnondominant feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
570amnondominant homo sapiens, feces, india, bihar state2019-12-16v3No1 / 15
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 15
596amnondominant 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 15
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
655amnon high in hematopoietic stem cell transplant after hcst compared to before hsct in italy feces homo sapiens 2020-09-13v3No1 / 15
658amnon high in african american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
658amnon high in hispanic hispanic or latin american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
685amnondominant oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 15
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 15
723amnoncommon municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 15
729amnondominant cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 15
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 15
777amnoncommon 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 15
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 15
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
802amnondominant cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 15
805amnondominant sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 15
806amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
806amnondominant dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
819amnoncommon dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 15
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 15
846amnondominant stimulated saliva, human adult stage, commonwealth of massachusetts, adult, saliva, united states of america, homo sapiens2021-11-20v3No1 / 15
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v4No1 / 15
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 15
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 15
925amnondominant vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 15
926amnondominant 2-5 year-old child stage, orenburg, supragingival dental plaque, supragingival plaque, russia, child, homo sapiens2022-07-28v3No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
51amnondominant homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
213amnondominant homo sapiens, south africa, vagina2017-10-22v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 16
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
399amnondominant pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
411amnondominant zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 16
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
528amnondominant homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
565amnondominant skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 16
565amnondominant skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 16
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 16
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
592amnondominant feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v1No1 / 16
598amnondominant 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 16
606amnonpositively correlated with age in human penis skin ( high in old age compared to young age in penis skin adult south africa homo sapiens male organism male )2020-04-15v3No1 / 16
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 16
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 16
625amnondominant feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 16
625amnondominant pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 16
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 16
656amnondominant child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 16
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
663amnondominant pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 16
678amnondominant control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 16
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 16
683amnondominant during antibiotics treatment in feces (dominant metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 16
710amnondominant ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 16
713amnon high in active disease compared to remission in crohn's disease feces homo sapiens 2028-05-21v3No1 / 16
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 16
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 16
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 16
794amnondominant control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 16
872amnondominant age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v4No1 / 16
892amnondominant 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v4No1 / 16
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 16
922amnondominant no dental caries, 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-07-25v4No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
208amnondominant mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
277amnondominant homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 17
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
570amnon high in control compared to visceral leishmaniasis in homo sapiens feces india bihar state 2019-12-16v3No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v3No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 17
606amnondominant penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 17
607amnondominant germany, homo sapiens, feces, control2020-04-19v4No1 / 17
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
611amnondominant caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 17
630amnondominant madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 17
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 17
639amnondominant nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 17
660amnondominant shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 17
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 17
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
725amnondominant periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 17
729amnondominant cameroon, wild, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 17
730amnondominant control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 17
743amnondominant feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 17
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 17
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
777amnondominant 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
777amnondominant 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
797amnon high in breast fed compared to formula fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 17
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 17
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 17
852amnondominant non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 17
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 17
892amnondominant 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 17
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 17
922amnondominant no dental caries, 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
95amnonhigh freq. in root canal (dominant homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 18
102amnon high in control compared to hiv infection in homo sapiens atlanta united states of america dentition mouth 2017-04-04v4No1 / 18
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 18
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 18
293amnondominant homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 18
331amnondominant feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 18
339amnondominant homo sapiens, feces, adult, india2018-05-24v4No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 18
423amnondominant bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 18
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 18
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 18
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 18
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 18
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 18
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
625amnondominant state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 18
625amnondominant emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 18
630amnon high in low physical activity sedentary compared to high physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 18
636amnon high in tracheal aspirate endotracheal aspirate trachea compared to oropharynx oropharyngeal swab in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 18
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 18
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 18
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 18
663amnondominant mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 18
666amnondominant european rabbit, oryctolagus cuniculus, italy, feces2020-09-25v3No1 / 18
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 18
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 18
715amnondominant oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 18
716amnondominant chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 18
717amnon high in male organism male compared to female organism female in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 18
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
770amnondominant age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 18
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 18
777amnoncommon 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant 18-month-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant 5-year-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
806amnondominant homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 18
806amnondominant mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
806amnondominant hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
817amnondominant united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v3No1 / 18
833amnondominant homo sapiens, feces, age 60-65 years, slovak republic, adult, normal exercise2021-09-11v1No1 / 18
841amnondominant human adult stage, state of texas, adult, saliva, united states of america, homo sapiens2021-11-08v4No1 / 18
848amnoncommon 6-month-old human stage, infant, kingdom of spain, feces, homo sapiens2021-12-13v1No1 / 18
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v3No1 / 18
875amnondominant human late adulthood stage, saen thong subdistrict, village, rural community, thailand, adult, homo sapiens, feces2022-03-04v3No1 / 18
880amnondominant human adult stage, kingdom of denmark, adult, homo sapiens, feces2022-03-12v3No1 / 18
885amnondominant human early adulthood stage, state of florida, united states of america, homo sapiens, feces2022-03-26v3No1 / 18
892amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
892amnondominant 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus colonic mucosa research facility 2022-05-20v3No1 / 18
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 18
922amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
922amnondominant no dental caries, 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 19
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin australia foot )2017-11-05v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 19
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
449amnondominant homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 19
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 19
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 19
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 19
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
671amnondominant age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 19
678amnondominant tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 19
679amnondominant south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
704amnondominant istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 19
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 19
723amnondominant adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
729amnondominant captive, monkey, feces, zoological garden, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 19
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 19
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 19
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 19
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 19
806amnondominant palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 19
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 19
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 19
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 19
925amnondominant interproximal dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 20
105amnondominant brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 20
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 20
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 20
203amnonlower in kids with frequent toothbrushing ( high in infrequent brushing compared to frequenct brushing toothbrushing in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 20
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (dominant homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnondominant homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 20
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 20
434amnondominant rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 20
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 20
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v4No1 / 20
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 20
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 20
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 20
639amnondominant lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 20
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 20
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 20
671amnondominant age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 20
677amnondominant palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 20
697amnondominant sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 20
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 20
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 20
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 20
730amnondominant crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 20
734amnondominant vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 20
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
851amnondominant milan, italy, adult, homo sapiens, feces2021-12-16v3No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 20
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v3No1 / 20
892amnondominant 1-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, infant, united states of america, homo sapiens2022-04-07v4No1 / 20
892amnondominant 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 20
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v3No1 / 20
922amnondominant no dental caries, 1-year-old human stage, supragingival dental plaque, supragingival plaque, infant, dentition, united states of america, homo sapiens2022-07-25v4No1 / 20
922amnondominant no dental caries, 4-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 21
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
278amnondominant homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 21
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 21
576amnondominant homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 21
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
596amnoncommon 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 21
658amnon high in hispanic hispanic or latin american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 21
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 21
663amnon high in low bmi compared to obese body mass index status high bmi obesity in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 21
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 21
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
717amnondominant inner nostril, pair of nares, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
726amnondominant tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 21
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 21
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 21
759amnondominant city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 21
773amnondominant iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 21
806amnondominant saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
835amnondominant feces, homo sapiens, japan, adult2021-09-11v3No1 / 21
848amnondominant 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 21
853amnondominant solid food diet, soild food supplemented diet, hyplus rabbit, age 5 weeks, juvenile, caecum, rabbit, cecal content, french republic, oryctolagus cuniculus, research facility2021-12-20v3No1 / 21
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 21
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v3No1 / 21
870amnondominant fourth decade human stage, third decade human stage, auckland city, new zealand, adult, homo sapiens, feces2022-02-18v3No1 / 21
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 21
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v4No1 / 21
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v4No1 / 21
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
925amnondominant lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 21
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v3No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 22
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 22
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
593amnondominant homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
625amnondominant black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 22
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 22
650amnondominant african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 22
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 22
666amnondominant european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 22
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v4No1 / 22
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, state of michigan, adult, oropharynx)2021-01-09v4No1 / 22
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 22
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 22
806amnoncommon gingiva, keratinized gingiva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 22
819amnoncommon adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 22
851amnondominant sigmoid colon brushing, milan, italy, adult, sigmoid colon, colonic mucosa, homo sapiens2021-12-16v3No1 / 22
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 22
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v3No1 / 22
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 22
10amnondominant homo sapiens, feces, toronto2016-10-27v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
53amnondominant homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 23
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to late timepoints age 35 weeks age in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 23
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 23
303amnondominant homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 23
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 23
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 23
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 23
666amnondominant homo sapiens, italy, feces2020-09-25v3No1 / 23
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 23
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 23
704amnondominant 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 23
712amnondominant kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 23
713amnondominant active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 23
717amnoncommon bellybutton, umbilicus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 23
717amnon high in female organism female compared to male organism male in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 23
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 23
773amnondominant recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v4No1 / 23
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v4No1 / 23
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v4No1 / 23
853amnon high in age 3 weeks compared to age 5 weeks in exclusive breastmilk diet juvenile cecal content caecum hyplus rabbit rabbit oryctolagus cuniculus french republic research facility 2021-12-18v3No1 / 23
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v3No1 / 23
892amnondominant 2-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 23
922amnondominant no dental caries, 2-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 24
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
260amnondominant homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 24
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 24
554amnondominant homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v4No1 / 24
620amnondominant feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 24
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v4No1 / 24
683amnondominant state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 24
685amnon high in morning compared to evening in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 24
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 24
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 24
717amnondominant bellybutton, umbilicus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 24
721amnonhigher in high protein weight loss diet compared to control diet ( high in high protein diet weight loss diet weight loss compared to control diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 24
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
723amnondominant 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 24
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 24
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 24
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v3No1 / 24
853amnondominant exclusive breastmilk diet, hyplus rabbit, juvenile, age 3 weeks, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-18v3No1 / 24
853amnondominant exclusive breastmilk diet, hyplus rabbit, age 5 weeks, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v3No1 / 24
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v1No1 / 24
916amnon high in restricted feed compared to control diet in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 24
923amnoncommon oral cavity, japan, research facility, sprague dawley, rattus norvegicus, rat2022-07-27v3No1 / 24
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 25
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 25
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 25
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 25
663amnoncommon pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 25
717amnoncommon armpit, axilla, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 25
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
770amnondominant age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
796amnondominant graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 25
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 25
848amnondominant 6-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 25
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v3No1 / 25
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 25
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 25
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v4No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 25
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 26
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 26
650amnonpositively correlated with BMI ( high in high bmi body mass index compared to low bmi in feces adult homo sapiens united states of america state of new york )2020-09-09v4No1 / 26
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 26
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 26
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 26
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 26
104amnondominant homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 27
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 27
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
685amnoncommon oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 27
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 27
717amnoncommon inner nostril, pair of nares, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 27
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 27
916amnon high in ad libitum diet control diet compared to restricted feed in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 28
319amnondominant homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
620amnondominant chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 28
651amnon high in female compared to male in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 28
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 28
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 28
817amnoncommon bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america state of texas saliva homo sapiens 2021-11-08v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
658amnon high in african american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 29
693amnon high in polycystic ovary syndrome compared to control in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 29
704amnon high in control compared to dental caries in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 29
711amnoncommon adult, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 29
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 29
806amnoncommon dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 29
817amnon high in bronchoalveolar lavage lung compared to saliva oral wash cheek pouch oral cavity in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 29
892amnoncommon supragingival plaque, supragingival dental plaque, 1-year-old human stage, dental plaque, infant, united states of america, homo sapiens2022-04-07v4No1 / 29
922amnoncommon dentition, supragingival plaque, supragingival dental plaque, infant, 1-year-old human stage, no dental caries, united states of america, homo sapiens2022-07-25v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 30
658amnon high in european caucasian compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
723amnoncommon 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 30
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 31
233amnon high in age age < 3 months compared to infant stage age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
651amnon high in male compared to female in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 31
681amnondominant seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 31
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 31
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 31
806amnoncommon hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 32
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
578amnon high in control compared to hiv infection in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 32
717amnoncommon upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 32
717amnoncommon external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 32
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 32
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 32
187amnonpositively correlated with age 25-35 weeks ( high in late time points age 35 weeks compared to early time points 25 weeks in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 33
279amnon high in small intestine stomach compared to mouth in pika ochotonidae china 2018-01-24v4No1 / 33
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens africa child duodenum 2018-12-08v4No1 / 33
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
611amnon high in female compared to male in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v3No1 / 33
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 33
892amnoncommon 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v4No1 / 33
922amnoncommon no dental caries, infant, 1-year-old human stage, saliva, united states of america, homo sapiens2022-07-25v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 34
528amnon high in african american african compared to caucasian in united states of america pregnancy vagina female homo sapiens 2019-07-14v1No1 / 34
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 34
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 34
919amnoncommon 9-month-old human stage, 8-month-old human stage, 7-month-old human stage, 6-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in 1-month-old human stage age age 1 week compared to 3-month-old human stage in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v4No1 / 35
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 35
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 35
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 35
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 35
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 36
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
399amnon high in ulcerative colitis compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 36
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
596amnoncommon 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 36
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v4No1 / 37
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
651amnon high in parkinson's disease compared to control in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
711amnoncommon age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 37
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 37
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v1No1 / 37
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v4No1 / 38
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
567amnon high in nasopharynx compared to anterior naris pair of nares in homo sapiens adult belgium 2019-12-05v4No1 / 38
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 38
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 38
679amnoncommon saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 38
806amnoncommon homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in fifth decade human stage fourth decade human stage age compared to human late adulthood stage in homo sapiens feces south korea )2017-04-16v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
677amnoncommon palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v1No1 / 39
909amnon high in age 6 weeks compared to age 18 weeks in colonic mucosa manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
378amnon high in deep pocket depth depth > 3mm compared to shallow pocket depth depth < 3mm in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 40
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 40
806amnoncommon mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 40
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
679amnon high in tonsil palatine tonsil compared to saliva in south korea age 5-10 years child fasting homo sapiens 2028-03-02v3No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in buccal mucosa mouth mucosa compared to oropharynx in adult state of michigan united states of america homo sapiens )2021-01-09v4No1 / 41
806amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v4No1 / 41
872amnoncommon age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v3No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 42
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v4No1 / 42
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 42
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 42
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v4No1 / 42
922amnoncommon 4-year-old human stage, no dental caries, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 43
892amnoncommon 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 44
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 44
717amnoncommon dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v3No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 45
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 45
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v3No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 46
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v1No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 47
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
853amnon high in exclusive breastmilk diet compared to solid food diet soild food supplemented diet in hyplus rabbit age 5 weeks juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-20v3No1 / 47
96amnon high in periodontitis compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 48
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
806amnoncommon palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 48
806amnon high in oral wash oral cavity compared to hard palate in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 48
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 48
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v3No1 / 48
892amnoncommon 2-year-old human stage, child, supragingival dental plaque, dental plaque, supragingival plaque, united states of america, homo sapiens2022-04-07v4No1 / 48
922amnoncommon 2-year-old human stage, child, no dental caries, supragingival dental plaque, supragingival plaque, dentition, united states of america, homo sapiens2022-07-25v4No1 / 48
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 49
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 49
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in mouth mucosa oral cavity indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 49
853amnon high in age 5 weeks compared to age 3 weeks in exclusive breastmilk diet hyplus rabbit juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-18v3No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens czech republic adult 2020-01-09v3No1 / 50
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 50
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
725amnoncommon control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 51
730amnoncommon crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 51
925amnoncommon vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 51
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 52
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v4No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in 14-year-old human stage 13-year-old human stage child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 52
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 52
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
730amnon high in control compared to crohn's disease in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v3No1 / 52
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
102amnon high in periodontitis compared to control in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 53
162amnon high in periodontitis compared to control in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 53
279amnon high in mouth compared to small intestine stomach in pika ochotonidae china 2018-01-24v4No1 / 53
279amnon high in small intestine stomach compared to caecum colon in pika ochotonidae china 2018-01-24v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
892amnon high in supragingival plaque supragingival dental plaque dental plaque compared to saliva in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 53
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
773amnoncommon iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 54
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 55
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 55
926amnoncommon 2-5 year-old child stage, supragingival plaque, supragingival dental plaque, child, orenburg, russia, homo sapiens2022-07-28v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
423amnon high in male compared to female in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 56
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
817amnon high in oral cavity cheek pouch oral wash saliva compared to bronchoalveolar lavage lung in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v4No1 / 56
922amnoncommon 4-year-old human stage, no dental caries, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 56
925amnoncommon lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 56
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v3No1 / 56
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
596amnoncommon 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 57
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
806amnon high in oral wash oral cavity compared to buccal mucosa mouth mucosa in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 57
892amnoncommon 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 57
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 58
806amnon high in oral wash oral cavity compared to supragingival plaque supragingival dental plaque dentition in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 58
866amnon high in iga negative fraction compared to iga positive fraction in human adult stage adult homo sapiens united states of america feces 2022-02-08v4No1 / 58
877amnon high in high breath methane content compared to low breath methane content in human early adulthood stage austria adult homo sapiens feces 2022-03-08v4No1 / 58
922amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 59
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
596amnoncommon 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 59
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 59
892amnoncommon 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 59
922amnoncommon child, 2-year-old human stage, no dental caries, saliva, united states of america, homo sapiens2022-07-25v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 60
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 60
925amnoncommon supragingival dental plaque, supragingival plaque, interproximal dental plaque, kingdom of spain, adolescent stage, homo sapiens2022-07-28v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
586amnon high in control diet compared to fructose diet fructose in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 61
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 62
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
851amnoncommon feces, milan, italy, adult, homo sapiens2021-12-16v3No1 / 62
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 62
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 63
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
163amnon high in ochotona dauurica mongolia grassland compared to ochotona curzoniae tibet platue in ochotonidae pika stomach china 2017-07-13v4No1 / 63
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 63
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 63
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
679amnoncommon south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 64
695amnon high in sesame allergy compared to milk allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 64
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 65
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
875amnoncommon saen thong subdistrict, village, rural community, thailand, adult, human late adulthood stage, feces, homo sapiens2022-03-04v3No1 / 65
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v4No1 / 65
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
852amnoncommon non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
805amnon high in non-smoker compared to cigarette smoking nicotine dependence smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 67
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v3No1 / 67
8amnon high in stomach compared to colon in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 68
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 68
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 68
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 69
846amnoncommon commonwealth of massachusetts, united states of america, human adult stage, adult, stimulated saliva, saliva, homo sapiens2021-11-20v3No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
386amnon high in ecuador compared to bolivia in mouse mus musculus caecum wild 2018-10-28v4No1 / 70
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 70
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
819amnon high in scalp compared to skin of cheek in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 70
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
656amnoncommon child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
851amnoncommon sigmoid colon brushing, colonic mucosa, sigmoid colon, milan, italy, adult, homo sapiens2021-12-16v3No1 / 71
853amnon high in soild food supplemented diet solid food diet compared to exclusive breastmilk diet in hyplus rabbit age 5 weeks juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-20v3No1 / 71
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v3No1 / 71
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v4No1 / 72
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
817amnoncommon united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v3No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
697amnoncommon sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 73
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 73
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v1No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 75
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v4No1 / 76
663amnon high in switzerland compared to poland in adult feces homo sapiens 2020-09-22v4No1 / 76
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 76
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
279amnoncommon pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common oropharynx, adult, state of michigan, united states of america, homo sapiens)2021-01-09v4No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
777amnoncommon 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 79
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 79
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v3No1 / 79
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
163amnoncommon ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 81
777amnon high in 3-year-old human stage compared to 5-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 81
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 81
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 82
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 82
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
716amnoncommon chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 82
853amnoncommon age 3 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-18v3No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
721amnon high in high protein diet weight loss weight loss diet compared to high fiber fiber diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 83
777amnoncommon 5-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 83
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in puerto rico cayo santiago macaca mulatta indian rhesus macaque oral cavity mouth mucosa 2021-04-19v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in newborn human stage age age <=24 hours compared to newborn human stage age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
731amnoncommon buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 85
802amnoncommon cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 85
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 85
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 85
108amnon high in caecum compared to colon in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
806amnoncommon oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 86
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
806amnon high in oral wash oral cavity compared to palatine tonsil in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 87
892amnoncommon saliva, united states of america, human adult stage, adult, homo sapiens2022-04-07v4No1 / 87
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 88
711amnon high in age 8-12 years child compared to adult in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 88
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v4No1 / 88
922amnoncommon human adult stage, united states of america, saliva, adult, homo sapiens2022-07-25v4No1 / 88
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 92
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
715amnoncommon oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 92
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
777amnoncommon 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 93
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 94
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 94
17amnon high in low altitude compared to high altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 95
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
770amnon high in penis male organism compared to vagina female organism in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
678amnoncommon tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 96
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
853amnoncommon age 5 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v3No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
730amnoncommon control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 97
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 98
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
704amnon high in dental caries compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 102
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 102
922amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 102
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
279amnoncommon pika, ochotonidae, mouth, china2018-01-24v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 104
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
704amnoncommon 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 106
663amnoncommon mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 106
712amnoncommon kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
806amnoncommon saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
273amnon high in 1-month-old human stage age compared to 1-month-old human stage age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
704amnoncommon istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 107
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 107
892amnon high in saliva compared to supragingival plaque supragingival dental plaque dental plaque in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 107
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 110
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v1No1 / 112
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v3No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
853amnoncommon soild food supplemented diet, solid food diet, hyplus rabbit, age 5 weeks, juvenile, caecum, rabbit, cecal content, french republic, oryctolagus cuniculus, research facility2021-12-20v3No1 / 114
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in 3-month-old human stage age compared to 1-month-old human stage age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
592amnoncommon wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v1No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
658amnon high in asian burmese compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 118
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 119
743amnoncommon feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 119
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 120
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
777amnon high in 5-year-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 120
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 121
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
636amnon high in oropharynx oropharyngeal swab compared to trachea endotracheal aspirate tracheal aspirate in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 122
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
598amnoncommon 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
806amnon high in dorsum of tongue compared to oral wash oral cavity in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 126
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 129
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 129
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 130
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 130
592amnoncommon wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v1No1 / 130
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in mus musculus mouse feces united states of america )2017-04-14v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
8amnon high in colon compared to stomach in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 132
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 132
851amnon high in feces compared to colonic mucosa sigmoid colon brushing sigmoid colon in adult milan italy homo sapiens 2021-12-16v3No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 133
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 134
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v3No1 / 135
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 136
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v4No1 / 138
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 140
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
279amnoncommon pika, ochotonidae, colon, caecum, china2018-01-24v4No1 / 146
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
710amnoncommon mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 151
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 152
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
885amnoncommon human early adulthood stage, state of florida, united states of america, feces, homo sapiens2022-03-26v3No1 / 152
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 154
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v1No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 157
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 157
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
678amnoncommon control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 161
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 163
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 163
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 164
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
906amnoncommon feces, sciurus carolinensis, grey squirrel, province of ontario, canada2022-05-19v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
658amnon high in asian burmese compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 168
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 170
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v3No1 / 170
666amnoncommon italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
594amnon high in ngoantet rural community compared to city yaounde in homo sapiens feces cameroon adult 2020-03-12v4No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v4No1 / 173
163amnoncommon stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 174
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v3No1 / 174
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
806amnon high in oral wash oral cavity compared to pair of nares external naris in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
759amnoncommon city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 179
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 180
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
639amnoncommon lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 182
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v3No1 / 185
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
423amnoncommon bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 187
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 188
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 188
197amnon high in india compared to finland in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v4No1 / 189
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
592amnoncommon united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 196
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
777amnon high in 3-month-old human stage compared to 2-days-old human in infant homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
592amnoncommon feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v1No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 205
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
658amnon high in asian burmese compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 212
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
759amnon high in commonwealth of massachusetts city of boston research facility compared to wild state of new york new york city in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 218
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 225
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v1No1 / 226
916amnon high in antimicrobial agent antibiotics supllemented diet antibiotic compared to normal diet control in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v1No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to 14-year-old human stage 13-year-old human stage child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v3No1 / 232
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 233
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
639amnon high in european brown hare lepus europaeus compared to oryctolagus cuniculus european rabbit in nature reserve adult wild australia feces 2020-08-21v3No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
620amnoncommon chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 238
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v4No1 / 238
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 242
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
916amnon high in control diet control compared to antibiotics supllemented diet antibiotic in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 246
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
666amnoncommon european rabbit, oryctolagus cuniculus, italy, feces2020-09-25v3No1 / 252
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 255
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 275
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v4No1 / 279
639amnoncommon nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 280
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
596amnon high in 2-5 year-old child stage age 1-7 years compared to under-1-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 288
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v3No1 / 288
806amnon high in oral wash oral cavity compared to keratinized gingiva gingiva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 288
861amnon high in peri-urban community rural community bushbuckridge local municipality compared to city urban community soweto in human middle aged stage female south africa feces homo sapiens 2022-01-15v3No1 / 289
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 291
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 291
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
723amnon high in 2-5 year-old child stage compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
625amnoncommon feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 309
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
729amnoncommon cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 321
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 325
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
710amnon high in feces compared to small intestine stomach in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 329
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in ochotonidae pika stomach china 2017-07-13v4No1 / 331
873amnon high in tanzania compared to botswana in human adult stage rural community africa adult homo sapiens feces 2022-03-03v1No1 / 333
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 336
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 337
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 351
620amnon high in nouabale-ndoki national park wild republic of congo pan troglodytes troglodytes compared to united states of america zoological garden pan troglodytes in chimpanzee feces 2020-05-06v4No1 / 351
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
916amnoncommon age 2 months, caecum, rabbit, oryctolagus cuniculus, research facility, kingdom of spain2022-07-04v4No1 / 361
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v4No1 / 363
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
876amnoncommon feces, age 20 months, juvenile organism, state of washington, united states of america, research facility, monkey, macaca mulatta2022-03-06v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
625amnoncommon son tra nature reserve, viet nam, pygathrix nemaeus, red-shanked douc, wild, feces2020-05-16v4No1 / 369
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
729amnon high in wild cameroon compared to captive zoological garden europe in gorilla gorilla monkey feces 2021-01-05v3No1 / 383
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 394
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
906amnon high in forested area compared to city in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
906amnon high in city compared to forested area in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 421
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
935amnoncommon monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v4No1 / 452
339amnon high in adult compared to under-1-year-old human stage infant in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 465
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in tenth decade human stage ninth decade human stage age >94 compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage in homo sapiens feces china )2018-12-30v4No1 / 474
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 475
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in nature reserve adult wild australia feces 2020-08-21v3No1 / 480
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v4No1 / 567
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 583
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage age >94 compared to young adult stage soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
279amnon high in caecum colon compared to stomach small intestine in pika ochotonidae china 2018-01-24v4No1 / 634
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
872amnon high in 2-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 704
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
671amnon high in 3-month-old human stage compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 1065
916amnon high in farm2 compared to farm1 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1191
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
916amnon high in farm1 compared to farm2 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1423
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684

Problems / suggestions? Please email info AT dbbact DOT org