Summary for ontology term: eucalyptus obliqua diet

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGAGATGTGCGAGCGTTGTTCGGAATCACTGGGCATAAAGGGTGCGTAGGCGGTGTGCCAAGTCGGGTGTGAAATCCCTTCGCTTAACGAAGGAACTGCACTCGATACTAGCACGCTAGAGGGTCAAAGGGGCAAGCGGAATTCTAGG0.250000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__BilophilaTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTGGTAAGTCAGGGGTGAAATCCCACAGCCCAACTGTGGAACTGCCTTTGATACTGCCAGGCTTGAGTACCGGAGAGGGTGGCGGAATTCCAGG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGCAGGCGGGACTGCAAGTCAGATGTGAAATGTACGGGCTCAACCCGTGCCCTGCATTTGAAACTGTGGTTCTTGAGTGAGGTAGAGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGCTGTATATCAAGTCAAGGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGAAACTGGTAAACTGGAGTATGTGAGAGGGTGGCGGAATTCCTGG0.250000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGGCTGGAGTGTCGGAGGGGTAAGCGGAATTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCTTAGCAAGCCAGAGGTGAAAACCCGGGGCCCAACCCCGCGGACTGCCTTTGGAACTGCATGGCTGGAGTGCTGGAGGGGCAGGCGGAATTCCTG0.250000
d__BacteriaTACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGTTCGTAGGCGGTATATCAAGTCTGGTGTTAAATACCGGGGCTCAACTCCGGCACGGCATTGGATACTGATAAACTTGAATGCGGTAGAGGTAAAGGGAATTCCTGG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAAGGAGCGCAGACGGCGAGACAAGTCTGAAGTGAAAGGCTGGGGCTTAACCCCGGGACTGCTTTGGAAACTGCCTGGCTAGAGTGCTGGAGGGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGAGCAGCAAGTCAGATGTGAAATCTCCGGGCTTAACCCGGAAACTGCATTTGAAACTGTTGCCCTTGGGTATCGGAGAGGCAAGCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTATAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGTTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACGGAAACTGGGAGACTTGAGTATCGGAGAGGAAAGCAGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGACCTTGAGTGCAACAGAGGTAGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCCTCTTAAGTCAGTGGTGAAAGTTTGTCGCTCAACGATAAAATTGCCATTGAAACTGGGGGGCTTGAGTATGTTTGAGGTAGGCGGAATGCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGACGGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGACTGCATTTGAAACTGTTGTTCTTGAGTGAGGTAGAGGTAAGCGGAATTCCTGG0.500000
d__BacteriaTACGGGGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGTTCGTAGGCGGCATGTCAAGTTTGGTGTTAAAGCCCGGGGCTCAACTCCGGTTCGGCATTGGATACTGGCAAGCTGGAATGCGGTAGAGGTGAAGGGAATTCCTGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGAGCAGCAAGTCAGATGTGAAATCTCCGGGCTTAACCCGGAAACTGCATTTGAAACTGTTGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCGTG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATATCAAGTCAGAAGTGAAAGCCCGGGGCTTAACCGCGGGACTGCTTTTGAGACTGATGAGCTGGAGTACAGGAGGGGTAAGCGGAATTCCTGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTGG0.666667
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGTACGTAGGCGGTCAGACAAGCGCAAGGTGAAAGGCACGGGCTTAACCGGTGTCAGCCTTGCGAACTGTCCGGCTTGAGTGCGGGAGAGGAAAGCGGAATTCCTGGT0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGGTCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGGCTCTTGAGTGCAGTATAGGCAGGCGGAATTCGTGG0.571429
d__Bacteria;p__"Proteobacteria"TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGCCCCGCAAGACGGACGTGAAATCCCCGGGCTCAACCCGGGGCGGCCGTACGTGACTGCGGAGCTGGAGTGCGTCAGAGGGGGGTGGAATTCCTGG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTATACAAGTCAGAAGTGAAAGCCCGGGGCTTAACCGCGGGACTGCTTTTGAAACTGTAGAGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTGG0.571429
d__Bacteria;p__Firmicutes;c__Negativicutes;o__SelenomonadalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGGAGAGTAAGTCTGTTGTTTAAATGCGGGGCTTAACCCCGTATCGCAATGGAAACTGCTTTTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.571429
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTGTTAAGTTAGAGGTGAAATTCCGGTGCTCAACACCGGCGCTGCCTCTGATACTGGCAGGCTAGAGTACAGATGCTGTGGGCGGAATGTATGG0.571429
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATGGTAAGTTAGGTGTGAAAACTATGGGCTTAACCGATAGAGTGCACTTAAAACTGCTGTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCTAG0.571429

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus obliqua diet0.500000
eucalyptus obliqua0.500000
LOWER IN eucalyptus viminalis0.500000
LOWER IN eucalyptus viminalis diet0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
LOWER IN eucalyptus obliqua diet0.500000
LOWER IN eucalyptus obliqua0.500000
australia0.043478
wild0.041667
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
australia1.000000
wild1.000000
phascolarctos cinereus1.000000
koala1.000000
cape otway1.000000
eucalyptus obliqua diet0.750000
eucalyptus obliqua0.250000
LOWER IN eucalyptus viminalis0.250000
LOWER IN eucalyptus viminalis diet0.250000
eucalyptus viminalis0.250000
eucalyptus viminalis diet0.250000
LOWER IN eucalyptus obliqua diet0.250000
LOWER IN eucalyptus obliqua0.250000

Problems / suggestions? Please email info AT dbbact DOT org