Summary for ontology term: european

Number of annotations with term: 14

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGCAGGCCTGCCTCGTTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAA0.300000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.300000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__KingellaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTTAGGGAAGAAAAGGATAATGTTAATACCATTATCTGCTGACGGTACCTAAAGAATAAGCACCGGC0.300000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCCAGTGAAGCAGGCCTGTCCCTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAACT0.300000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGTAAGTTAGTTGTGAAATCCCTCGGCTCAACTGAGGAACTGCGACTAAAACTGCTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.200000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGAAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGAGTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.200000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGATGAAGGCCTTCGGGTTGTAAAGCACTTTTGGCGGGAACGAAAAGGACTGTGCCAATACCACGGTTCGATGACGGTACCCGCAGAATAAGCACCGGC0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGGGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.200000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaGTAAGAATATTCCGCAATGGGGGGAACCCTGACGGAGCGACGCCGCGTGAACGAAGAAGGCCGGAAGGTTGTAAAGTTCTTTTCTGTCCGAGGAATAAGTGTAGGAGGAAATGCCTGCATGGTGACGGTAGGGCAGGAATAAGCACCGGC0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTGAGTTACGTGTAACTTATTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATGATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGGAAGTCTGACGGAGCGACGCCGCGTGGATGAAGAAGGCTGAAAAGTTGTAAAATCCTTTTGTTGATGAAGAATAAGGGTGAGAGGGAATGCTCATCTGATGACGGTAATCGACGAATAAGCCCCGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATCTCGGTACGTAAAGCTCTATCAGCAGGGAAGAAAAAAGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGCACGGGACGAAAACCGAGCTTGAAAATATTGAGCTTGGGTGACGGTACCGAGCGAGGAAGCCACGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__PropionibacteriaceaeTGGGGAATATTGCACAATGGACGGAAGTCTGATGCAGCAACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTCATCCATGACGAAGCTTTTGTGACGGTAGTGGGTAAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.333333
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGACAATGGTCGGAAGACTGATCCAGCCATGCCGCGTGCAGGAAGACGGCCTTATGGGTTGTAAACTGCTTTTGCAGGGGAAGAATAAGGACTACGAGTAGTTTGATGACGGTACTCTGCGAATAAGCATCGGCTAACT0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGCAGGATGAAGGCCCTCGGGTTGTAAACTGCTTTTGTACAGAACGAAAAAGGCCTGGCTAATATCTGGGTCTCATGACGGTACTGTAAGAATAAGCACCGGC0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__KingellaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTTAGGGAAGAAAAGGATAATGTTAATACCATTATCTGCTGACGGTACCTAAAGAATAAGCACCGGC0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGTTAGGGACGAAGCCACACCTTTTTTGGGTGTGGTGACGGTACCTTTGTTAAGAAGCACCGGCTAAC0.230769
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGTCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAGGAAGGCCTTGCCCGTGTGGTGGGGTTGACGGTAGCTGGGTTAATTGAAGCGCCGGCTA0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCCAGTGAAGCAGGCCTGTCCCTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAACT0.173913
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGATGGATAGGCAAGTTGGTTGTGAAATACCTCGGCTCAACTGAGGAACTGCAGCCAAAACTACAAATCTTGAGTACTGGAGGGGAAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGAGTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGTGCAAGTCTGGAGTGAAAACCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGTATCTAGAGTGCTGGAGAGGCAAGTGGAATTCCTAG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGTGGGAATAAAGTGGCGCACGCGTGCGCCATTGCATGTACCTCATGAATAAGGACCGGCTAATT0.166667

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN asian0.666667
asian0.666667
caucasian0.500000
european0.500000
burmese0.500000
LOWER IN caucasian0.500000
LOWER IN european0.500000
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
LOWER IN burmese0.500000
american0.500000
LOWER IN cheyenne0.500000
LOWER IN native american0.500000
LOWER IN arapaho0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
LOWER IN american0.500000
7-year-old human stage0.333333
hispanic0.333333
LOWER IN hispanic0.333333
state of oklahoma0.333333
state of nebraska0.250000
african american0.250000
LOWER IN african american0.250000
hispanic or latin american0.250000
LOWER IN hispanic or latin american0.250000
supragingival dental plaque0.142857
supragingival plaque0.100000
state of new york0.083333
dentition0.043478
child0.027778
united states of america0.012146
homo sapiens0.011070
feces0.006369
adult0.005780
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america1.000000
caucasian0.571429
european0.571429
dentition0.571429
child0.571429
state of nebraska0.571429
supragingival plaque0.571429
supragingival dental plaque0.571429
6-year-old human stage0.571429
7-year-old human stage0.571429
8-year-old human stage0.571429
9-year-old human stage0.571429
10-year-old human stage0.571429
11-year-old human stage0.571429
feces0.428571
adult0.285714
state of new york0.285714
LOWER IN caucasian0.285714
LOWER IN european0.285714
LOWER IN asian0.142857
asian0.142857
state of oklahoma0.142857
burmese0.071429
LOWER IN burmese0.071429
african american0.071429
LOWER IN african american0.071429
hispanic or latin american0.071429
hispanic0.071429
LOWER IN hispanic or latin american0.071429
LOWER IN hispanic0.071429
american0.071429
LOWER IN cheyenne0.071429
LOWER IN native american0.071429
LOWER IN arapaho0.071429
cheyenne0.071429
native american0.071429
arapaho0.071429
LOWER IN american0.071429
Exp. ID User ID Description Date Region Flag Sequences
242amnonlower in native-americans compared to non native-american ( high in american compared to cheyenne native american arapaho in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 6
658amnon high in caucasian european compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in african american compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 23
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475

Problems / suggestions? Please email info AT dbbact DOT org