Summary for ontology term: farm

Number of annotations with term: 230

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.013158
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.008772
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.008772
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.008772
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.008772
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.008772
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCGAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCCTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.008772

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__StomatobaculumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCTCTGCAAGTCTGAAGTGAAAGCCCGCGGCTTAACCGCGGGACTGCTTTGGAAACTGCAAGGCTTGAGTATCGGAGGGGCAGGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTAATAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGTTAGACTTGAGTGCAGTAGAGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__CytophagaceaeTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGCAGGTGGTTTATTAAGTCAGTGGTGAAAGACGGTCGCTCAACGATTGCAGTGCCATTGAAACTGGTAGACTTGAGTAAAGTAGAGGTGGGCGGAATTGATAG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.153846
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTAAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.131274
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.129380
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.129278
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.123667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGGAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.122744
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.115607
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTACTTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGGGTAACTAGAGTAGGTGAGAGGGGAGTAGAATTCCAGG0.112000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTTTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.109804
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCAGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.109422

Annotations:

common ontology terms
term enrichment score
TermScore
farm0.993435
sus scrofa0.244405
pig0.239856
equus caballus0.191126
horse0.191126
canada0.181132
cannabis sativa0.172662
gallus gallus0.144082
china0.130273
cultivated environment0.129496
state of michigan0.125000
chicken0.118721
broiler chicken0.113208
greenhouse soil0.112601
tonsil0.111888
pasture0.111554
intestine0.103226
free range chicken0.101562
bos taurus0.091148
cow0.087591
rhizosphere0.083799
caecum0.076294
captive0.074324
root endosphere0.067669
adula0.067227
feces0.066374
snake farm0.065041
barn0.065041
milk0.065041
cow milk (fluid)0.065041
cow milk (raw)0.065041
fragaria x ananassa0.065041
strawberry0.065041
yellow brown soil0.065041
deer0.065041
kingdom of spain0.063584
snake0.062992
hay0.062992
shanghai proper0.062992
ph>70.062992
clay loam0.062992
nanjing city prefecture0.062992
pair of nares0.061433
italy0.060606
age 4 weeks0.057931
ireland0.057377
hunan province0.055944
state of georgia0.054422
turtle farm0.049587
flowering stage0.049587
united states of america0.048564
tibet autonomous region0.048387
agricultural feature0.047904
hainan autonomous prefecture0.047244
rumen0.046667
nasal cavity0.045603
cecal content0.045113
jiangxi province0.045113
skin0.044199
soil0.043689
oral cavity0.042683
yuzhong county0.042553
moschus chrysogaster0.042553
ph 7-80.041885
30-60 days0.041667
lowland pasture0.041667
lowland farm0.041667
early flowering stage0.041667
late flowering stage0.041667
glycine max0.040404
mouth0.040359
new zealand0.040000
late timepoints0.035714
age 2 weeks0.033898
trachemys scripta elegans0.033613
red-eared slider turtle0.033613
penaeus monodon0.033613
black tiger shrimp0.033613
shrimp farm0.033613
edinburgh0.033613
maojian district0.033613
andrias davidianus0.033613
chinese giant salamander0.033613
omsk0.033613
peking duck0.033613
age 100 days0.033613
pre-vegetative stage0.033613
organic farming0.033613
jinhua city prefecture0.033613
jinhua pig0.033613
age 3 years0.033058
united kingdom0.032609
npk fertilizer0.032520
anas platyrhynchos0.032520
lamb0.032520
age 3 weeks0.032520
adult0.032043
intestinal contents0.032000
age 6 weeks0.032000
thailand0.031496
Fraction of dbbact annotations with this term covered by the query
TermScore
spring3.000000
LOWER IN spring3.000000
farm1.000000
adula1.000000
qilian county1.000000
moschus berezovskii1.000000
yuzhong county1.000000
moschus chrysogaster1.000000
LOWER IN yuzhong county1.000000
LOWER IN moschus chrysogaster1.000000
LOWER IN qilian county1.000000
LOWER IN moschus berezovskii1.000000
greenhouse soil0.750000
pasture0.666667
age 2 weeks0.666667
age 4 weeks0.600000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
0-2 days0.500000
LOWER IN 30-60 days0.500000
30-60 days0.500000
LOWER IN 0-2 days0.500000
unshaded0.500000
sunlight0.500000
LOWER IN shaded0.500000
shaded0.500000
LOWER IN unshaded0.500000
LOWER IN sunlight0.500000
neonate stage0.500000
age 0 days0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
snake farm0.500000
elaphe carinata0.500000
king ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
orthic anthrosol0.500000
penaeus monodon0.500000
black tiger shrimp0.500000
barn0.500000
decreased weight0.500000
bottom weight group0.500000
LOWER IN increased weight0.500000
LOWER IN top weight group0.500000
shrimp farm0.500000
caudal teeth0.500000
LOWER IN rostral teeth0.500000
edinburgh0.500000
maojian district0.500000
andrias davidianus0.500000
chinese giant salamander0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
tibetan pig0.500000
tibetan swine0.500000
ireland0.500000
LOWER IN barn0.500000
LOWER IN asthma0.500000
omsk0.500000
peking duck0.500000
asthma0.500000
age 100 days0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
age 3 days0.500000
free range chicken0.500000
age 4 days0.500000
age 12 weeks0.500000
LOWER IN typhlitis0.500000
typhlitis0.500000
LOWER IN free range chicken0.500000
alpine0.500000
alpine pasture0.500000
LOWER IN lowland pasture0.500000
LOWER IN lowland farm0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
lowland pasture0.500000
lowland farm0.500000
LOWER IN alpine0.500000
LOWER IN alpine pasture0.500000
june0.500000
LOWER IN october0.500000
october0.500000
LOWER IN june0.500000
cannabis sativa0.500000
propagation stage0.500000
pre-vegetative stage0.500000
early flowering stage0.500000
late flowering stage0.500000
Fraction of annotations for the query sequences containing the term
TermScore
farm0.986957
china0.326087
feces0.252174
canada0.208696
united states of america0.169565
sus scrofa0.169565
pig0.165217
equus caballus0.121739
horse0.121739
caecum0.121739
gallus gallus0.121739
chicken0.113043
rhizosphere0.108696
cannabis sativa0.104348
kingdom of spain0.095652
state of michigan0.086957
soil0.078261
cultivated environment0.078261
intestine0.069565
tonsil0.069565
broiler chicken0.065217
greenhouse soil0.060870
pasture0.060870
bos taurus0.056522
free range chicken0.056522
cow0.052174
adult0.052174
captive0.047826
italy0.043478
saliva0.039130
mouth0.039130
pair of nares0.039130
root endosphere0.039130
root0.039130
state of georgia0.034783
hunan province0.034783
adula0.034783
snake0.034783
snake farm0.034783
hay0.034783
barn0.034783
agricultural feature0.034783
shanghai proper0.034783
ph>70.034783
ph 7-80.034783
clay loam0.034783
skin0.034783
milk0.034783
cow milk (fluid)0.034783
cow milk (raw)0.034783
fragaria x ananassa0.034783
nanjing city prefecture0.034783
strawberry0.034783
yellow brown soil0.034783
deer0.034783
oral cavity0.030435
ireland0.030435
nasal cavity0.030435
control0.030435
rumen0.030435
age 4 weeks0.030435
hainan autonomous prefecture0.026087
turtle farm0.026087
tibet autonomous region0.026087
cecal content0.026087
flowering stage0.026087
united kingdom0.026087
jiangxi province0.026087
late timepoints0.021739
30-60 days0.021739
glycine max0.021739
new zealand0.021739
LOWER IN control0.021739
lowland pasture0.021739
lowland farm0.021739
early flowering stage0.021739
late flowering stage0.021739
yuzhong county0.021739
moschus chrysogaster0.021739
alpine musk deer0.021739
xinglong mountain national nature reserve0.021739
trachemys scripta elegans0.017391
red-eared slider turtle0.017391
water0.017391
thailand0.017391
penaeus monodon0.017391
black tiger shrimp0.017391
shrimp farm0.017391
dentition0.017391
scotland0.017391
edinburgh0.017391
maojian district0.017391
andrias davidianus0.017391
chinese giant salamander0.017391
age 3 years0.017391
npk fertilizer0.017391
anas platyrhynchos0.017391
russia0.017391
intestinal contents0.017391
omsk0.017391
Exp. ID User ID Description Date Region Flag Sequences
599amnon high in caudal teeth compared to rostral teeth in farm dentition equus caballus scotland horse edinburgh 2020-03-25v4No1 / 1
384amnon high in asthma compared to control in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 1
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in farm rumen ovis aries child ireland sheep lamb age 100 days )2019-02-26v4No1 / 1
439amnonpresent only in abomasum in yak rumen ( high in abomasum compared to ruminant reticulum omasum in farm rumen bos grunniens yak china )2018-12-31v4No1 / 2
747amnonanti-correlated in soy bean root nodules (other united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 2
478amnondominant farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 3
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 3
420amnonhigh freq. in soil of vegetable open field (dominant agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 4
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 4
617amnon high in june spring compared to autumn october in farm milk italy cow milk (fluid) cow milk (raw) lowland pasture lowland farm 2020-05-03v3No1 / 4
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
420amnonhigh freq. in soil of vegetables in organic plastic tunnel (dominant agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in farm rumen ovis aries child ireland sheep lamb age 100 days )2019-02-26v4No1 / 4
420amnonhigh freq. in soil of vegetable in plastic tunnel (dominant agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 5
448amnonhigh freq. in healthy horse feces (dominant feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 5
592amnondominant feces, united states of america, farm, bos taurus, commonwealth of pennsylvania, cow2020-02-18v1No1 / 6
480amnon high in ph 5-6 compared to ph ph 6-7 in farm pasture soil new zealand 2019-02-05v4No1 / 6
480amnondominant farm, pasture, soil, new zealand2019-02-05v4No1 / 6
384amnon high in control compared to asthma in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 6
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 6
420amnonhigh freq. in soil of vegetables in organic field (dominant agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 6
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 6
478amnondominant farm, sediment, shrimp farm, china2019-02-19v4No1 / 7
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
565amnondominant farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 7
531amnondominant farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 8
474amnondominant farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 8
599amnon high in caudal teeth compared to rostral teeth in farm dentition equus caballus scotland horse edinburgh 2020-03-25v4No1 / 8
480amnondominant farm, pasture, soil, ireland2019-02-05v4No1 / 8
618amnondominant farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 8
466amnondominant feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 9
497amnondominant feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 9
778amnon high in increased weight top weight group compared to decreased weight bottom weight group in farm intestine thailand penaeus monodon black tiger shrimp 2021-04-28v3No1 / 9
863amnondominant feces, farm, captive, deer, china, qilian county, moschus berezovskii, forest musk deer2022-01-28v4No1 / 9
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
530amnondominant feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
497amnondominant feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 10
618amnondominant farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 10
565amnondominant farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 10
590amnondominant farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 11
384amnondominant farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 11
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 11
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 11
444amnon high in spring compared to winter in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
478amnondominant farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 11
863amnondominant feces, farm, captive, deer, china, yuzhong county, moschus chrysogaster, alpine musk deer, xinglong mountain national nature reserve2022-01-28v4No1 / 11
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 12
840amnondominant farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 12
618amnondominant farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 12
565amnondominant farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 12
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
530amnondominant feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 13
480amnon high in ph ph 6-7 compared to ph 5-6 in farm pasture soil new zealand 2019-02-05v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
618amnondominant farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 13
530amnondominant feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
384amnondominant farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 14
790amnondominant farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 14
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
617amnon high in autumn october compared to june spring in farm milk italy cow milk (fluid) cow milk (raw) lowland pasture lowland farm 2020-05-03v3No1 / 14
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
778amnondominant farm, intestine, thailand, penaeus monodon, black tiger shrimp2021-04-28v3No1 / 15
384amnondominant farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 15
618amnondominant farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 15
590amnoncommon in turtle pond water (dominant farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 16
314amnondominant farm, caecum, tibet autonomous region, cecal content, tibetan pig, tibetan swine, china2018-04-10v4No1 / 16
491amnondominant farm, rumen, ovis aries, child, ireland, sheep, lamb, age 100 days2019-02-26v4No1 / 16
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 16
448amnondominant feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
590amnondominant farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 17
661amnondominant farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 17
743amnondominant feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 17
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 18
384amnondominant farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 18
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 18
599amnondominant farm, dentition, equus caballus, scotland, horse, edinburgh2020-03-25v4No1 / 19
599amnoncommon farm, dentition, equus caballus, scotland, horse, edinburgh2020-03-25v4No1 / 19
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 19
480amnon high in new zealand compared to ireland in farm pasture soil ph 6-7 2019-02-05v4No1 / 20
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 20
439amnondominant farm, rumen, bos grunniens, yak, china2018-12-31v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
497amnoncommon feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 21
618amnondominant farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 21
759amnondominant feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 21
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
314amnondominant farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 23
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 24
618amnondominant farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
778amnoncommon farm, intestine, thailand, penaeus monodon, black tiger shrimp2021-04-28v3No1 / 25
661amnondominant farm, intestine, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 25
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 25
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 27
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 27
530amnondominant feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 28
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 28
590amnoncommon farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
863amnon high in spring compared to winter in feces farm captive deer china yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve 2022-01-28v4No1 / 29
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
778amnon high in decreased weight bottom weight group compared to increased weight top weight group in farm intestine thailand penaeus monodon black tiger shrimp 2021-04-28v3No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
618amnoncommon farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 44
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
439amnoncommon farm, rumen, bos grunniens, yak, china2018-12-31v4No1 / 52
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
618amnon high in cbd yummy cannabis plant compared to cbd shark cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 83
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
495amnon high in broiler chicken compared to free range chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 90
480amnon high in ireland compared to new zealand in farm pasture soil ph 6-7 2019-02-05v4No1 / 94
491amnoncommon farm, rumen, ovis aries, child, ireland, sheep, lamb, age 100 days2019-02-26v4No1 / 105
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
863amnon high in winter compared to spring in feces farm captive deer china yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve 2022-01-28v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
618amnon high in cbd shark cannabis plant compared to cbd yummy cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 139
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 152
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 157
384amnon high in hay barn compared to pasture in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 161
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 185
661amnoncommon farm, intestine, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
618amnon high in cbd shark cannabis plant compared to hash cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 197
495amnon high in free range chicken compared to broiler chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 199
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine alpine pasture compared to lowland pasture lowland farm in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 204
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 205
863amnoncommon feces, farm, captive, deer, china, qilian county, moschus berezovskii, forest musk deer2022-01-28v4No1 / 206
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 214
466amnoncommon in cow feces left in field for 30-60 days (common feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 221
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 236
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
618amnon high in cbd yummy cannabis plant compared to hash cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 250
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
863amnoncommon feces, farm, captive, deer, china, yuzhong county, moschus chrysogaster, alpine musk deer, xinglong mountain national nature reserve2022-01-28v4No1 / 290
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 318
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 352
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 412
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 416
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 432
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
314amnoncommon farm, caecum, tibet autonomous region, cecal content, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
448amnoncommon in healthy horse feces (common feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 508
618amnon high in root endosphere root compared to rhizosphere in farm canada cannabis sativa 2020-05-04v4No1 / 510
618amnoncommon farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 530
618amnon high in late flowering stage compared to early flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 533
444amnonhigher in continuously cropped strawberry soil ( high in age 5 years age 10 years continuous cropping compared to age 1 year in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 602
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
592amnoncommon feces, united states of america, farm, bos taurus, commonwealth of pennsylvania, cow2020-02-18v1No1 / 633
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 662
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
618amnoncommon farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 819
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
618amnoncommon farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 873
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
448amnon high in control compared to equine grass sickness disease in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 1084
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
863amnon high in yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve compared to qilian county moschus berezovskii forest musk deer in feces farm captive deer china 2022-01-28v4No1 / 1311
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 1329
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
863amnon high in qilian county moschus berezovskii forest musk deer compared to yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve in feces farm captive deer china 2022-01-28v4No1 / 1604
618amnon high in rhizosphere compared to root endosphere root in farm canada cannabis sativa 2020-05-04v4No1 / 3134

Problems / suggestions? Please email info AT dbbact DOT org