Summary for ontology term: farm 1

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTATTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGATGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__VerrucomicrobiaceaeTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTACGTAGGCTGCACCATAAGTCGCGCGTGAAAGGCAGGGGCTCAACCTCTGGAGTGCGCATGATACTGTGGTGCTGGAGTAATGGAGGGGGAACCGGAATTCTTGG0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGTGTAGGCGGTTTTACAAGTTAGATGTGAAATACCCAGGGCTTAACTCGGGTGCTGCATCTAAGACTGTAAGACTTGAGTGTCGGAGAGGTAAATGGAATTCCTA0.500000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGCAGGCGGGAACGCAAGTTGGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATCCAAAACTGTGATTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCGAG0.500000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGACAGCAAGTTGGATGTGAAATACCGAGGCTTAACCACGGAGCTGCATCCAAAACTGTTGTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCAGTATAAGTCCGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGAGACTGTACAGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.500000
d__BacteriaTACGTAGGGGACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGGCGGCATATTAAGTTTAAGATAAAAGCCCGGGGCTTAACTCCGGTTCGTCTTAAAAACTGATAAGCTTGAGTGTGGTAGAGGTAAATGGAATTTCTAGT0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTGTTAAGTCTGAGATGAAAGGCTGTGGCTCAACCACAGTTTGTTTCAGATACTGGCAGACTAGAGTGCAGTAGAGGCAATTGGAATTCATAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCAAGATAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGATTGCTTTGGAAACTGTAGTGCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATCTTTCTTGAGTGCGGGAGAGGAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGAGAGACAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGTTTTTCTTGAGTGCACATGAGGGTGGTGGAATTCGTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGAATGCAAGTCAGAAGTGAAAACTATGGGCTCAACCCATAGCCTGCTTTTGAAACTGTATTTCTTGAGTGAAGCAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__TissierellaTACGTAGGGGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGTTCGCAGGCGGTCTCTTAAGTTAGATGTGAAAGATCACGGCTCAACCGTGGTAAGCATTTAAAACTGGGAGACTTGAGTTAAGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACATCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAGACTGCATTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGTCTGCAAGTCAGTCGTGAAATACCGGGGCTTAACTCCGGGGCTGCGATTGAAACTGTAGATCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTCGTGCAAGCTTGGTGTGAAATCCCGGGGCTTAACTCCGGGACTGCGTTGAGAACTGCACGGCTAGAGTAACTGAGGGGCAGCCGGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGGCTGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCAAACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGTGACTGCATTGGAAACTGTTTTGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTCTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAAGTGCATCGGAAACTGGATAACTTGAGTGCAAGAGAGGACAGTGGAACTCCATG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGTGTAAAGGGCGTGTAGGCGGCTGATTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGAGACTGGTCGGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.500000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTGATAAGTCAGATGTGAAATGTATGGGCTCAACCCATGCACTGCATTTGAAACTATCGAGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCTG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCATGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTATGGCTCGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MitsuokellaTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATGGAAACTATCTTTCTTGAGTGTAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAATTATGGGCTCAACCCATAACCTGCATTTGAAACTGTGCTTCTTGAGTACTGGAGAGGCAGGCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTATCCGGAATTACTGGGTGTAAAGGGCGTGTAGGCGGGCAAGCAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTACTAGTCTTGAGTGTCGGAGAGGGAAGCGGAATTCCTAG0.500000
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTAATCTAAGCTTGGTGTGAAAGGCAGGGGCTTAACTCCTGGACTGCATTGAGAACTGGATGACTAGAGTTACTGAAGTGGAATCAGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGCTCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTCAGACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGGACAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTGACCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGTAGGTCAGATGTGAAATACCGGGGCTTAACCCCGGAGCTGCATTTGAAACCGCAGTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
jinhua city prefecture0.666667
jinhua pig0.666667
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000
sus scrofa0.117647
pig0.117647
farm0.052632
china0.010753
feces0.005780
Fraction of dbbact annotations with this term covered by the query
TermScore
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000
sus scrofa0.062500
pig0.062500
farm0.027027
china0.005405
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa1.000000
pig1.000000
jinhua city prefecture1.000000
jinhua pig1.000000
feces1.000000
farm1.000000
china1.000000
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000

Problems / suggestions? Please email info AT dbbact DOT org