Summary for ontology term: female

Number of annotations with term: 277

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGTCTATTAAGCGTGTTGTGAAATTTACCGGCTCAACCGGTGGCTTGCAGCGCGAACTGGTCGACTTGAGTATGCAGGAAGTAGGCGGAATTCATGG0.023529
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCCGGCAAGTCAGATGTGAAATCTGGAGGCTTAACCTCCAAACTGCATTTGAAACTGTAGGTCTTGAGTACCGGAGAGGTTATCGGAATTCCTTG0.023529
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.019608
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__EisenbergiellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGACAAGCCAGATGTGAAAACCCAGGGCTCAACCCTGGGACTGCATTTGGAACTGCCAGGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.019608
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTGGAAACTGTTTAACTGGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.019608
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCTG0.019608
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.015686
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.015686
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__AnaerococcusTACGTAAGGTCCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGTACGTAGGCGGGTAAGCAAGTTAGAAGTGAAATCCTATAGCTCAACTATAGTAAGCTTTTAAAACTGCTCATCTTGAGGTATGGAAGGGAAAGTGGAATTCCTAGT0.015686
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.015686

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.208333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGGTCATCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.208333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCGTCGTAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGCGATGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.208333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.208333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGTAGGCCGCCTTTTAAGCGTGTTGTGAAATGTAGGGGCTCAACCCCTGCACTGCAGCGCGAACTGGAGGGCTTGAGTACACACAAAGTAGGCGGAATTCATGG0.208333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MitsuokellaTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATGGAAACTATCTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.208333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTATCTAAGCGTAAGGTTTAAGCGTGCAGCTCAACTGCATCTCGCCTTGCGAACTGGACTACTTGAGTGCAGGAGGGGAAAGCGGAATTCCTAGT0.166667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.132196
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.122807
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.119904
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGATAATGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTA0.117925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGGAGTGAAATGCCGGGGCCCAACCCCGGAACTGCTTTGGAAACTGTGCAGCTCGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.117284
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.116343
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.112412
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.111475
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTAATTGAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG0.110769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCAGACAAGTCTGAAGTGAAAATCCAGCGCTTAACGTTGGAAGTGCTTTGGAAACTGCCGGGCTAGAGTGCAGGAGGGGCAGGCGGAATTCCTAG0.106509

Annotations:

common ontology terms
term enrichment score
TermScore
female0.963890
adult0.239422
mouse0.234771
pregnancy0.227652
mus musculus0.222705
homo sapiens0.217487
feces0.202559
research facility0.186648
vagina0.165387
united states of america0.142885
male0.134767
LOWER IN male0.134767
LOWER IN female0.134164
age 25-45 years0.130293
skin0.123810
c57bl/60.123526
panama0.103152
whole body0.102151
china0.085633
body proper0.075789
female organism0.071990
c57bl/6j0.071217
gestational diabetes0.069686
balb/c0.068536
janvier labs0.067340
control0.063070
captive0.062338
shanghai district0.061962
skin of cheek0.061017
caecum0.060046
state of oregon0.059211
germany0.058333
phoenix0.056140
indonesia0.054608
municipality of yogyakarta0.054608
state of california0.052381
south korea0.051780
state of arizona0.051780
LOWER IN control0.050123
ovariectomy0.048696
scalp0.048110
age 18 weeks0.048110
canada0.046557
obesity0.046434
diet0.045249
rhesus macaque0.041522
san diego zoo0.041522
culicoides <genus>0.041522
biting midge0.041522
sand fly0.041522
mosquito0.041522
baoding city prefecture0.041522
ismailia0.041522
pemba island0.041522
age 38 weeks0.041522
high sugar diet0.041522
dalian city prefecture0.040678
nanjing city prefecture0.040678
high fat diet0.039867
fifth decade human stage0.039867
tanzania0.039867
oral cavity0.039344
guangzhou city prefecture0.039088
macaca mulatta0.038339
egypt0.038339
fourth decade human stage0.037618
digesta0.037618
mouse chow0.037267
saliva0.036427
sheep0.035608
third trimester0.035461
turin township0.035461
age 2 months0.034843
ovis aries0.034384
jackson laboratories0.034247
age 9 weeks0.034247
monkey0.033241
south africa0.033241
rattus norvegicus0.033241
infant0.032990
zoological garden0.032698
rat0.031169
city0.030581
rumen0.030227
rural community0.030120
dentition0.029895
mus musculoides0.028070
nyulmc0.028070
nod/shiltj (no. 001976, jackson labs)0.028070
nod mouse0.028070
amsterdam0.028070
age 50-70 years0.028070
age 9 months0.028070
overweight body mass index status0.027682
human middle aged stage0.027682
graz city district0.027304
obese body mass index status0.027304
seoul0.027304
third decade human stage0.027304
state of new york0.026578
Fraction of dbbact annotations with this term covered by the query
TermScore
female1.015873
phoenix1.000000
third trimester1.000000
gestational diabetes1.000000
turin township1.000000
postmenopausal1.000000
buffalo1.000000
pregnancy0.916667
first trimester0.666667
LOWER IN polycystic ovary syndrome0.666667
shanghai district0.666667
age 25-45 years0.666667
ovariectomy0.666667
male0.606061
LOWER IN male0.606061
african0.500000
LOWER IN african0.500000
cervical carcinoma0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
dysplasia of cervix0.500000
LOWER IN dysplasia of cervix0.500000
age 2 months0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
LOWER IN pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
ukraine0.500000
bank vole0.500000
myodes glareolus0.500000
nod mouse0.500000
LOWER IN experimental autoimmune encephalomyelitis0.500000
experimental autoimmune encephalomyelitis0.500000
skh-1 hairless mouse0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
zinc deficiency0.500000
low zinc diet0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 8 months0.500000
san diego zoo0.500000
ceratotherium simum simum0.500000
LOWER IN ceratotherium simum simum0.500000
culicoides <genus>0.500000
culicoides foxi0.500000
biting midge0.500000
amsterdam0.500000
culicoides helicaniae0.500000
culicoides batesi0.500000
lutzomyia gomezi0.500000
sand fly0.500000
psychodopygus panamensis0.500000
nyssomyia trapidoi0.500000
culex coronator0.500000
mosquito0.500000
coquillettidia0.500000
coquilettidia venezuelensis0.500000
culex declarator0.500000
LOWER IN last trimester0.500000
last trimerster0.500000
premature birth0.500000
LOWER IN premature birth0.500000
duroc pig0.500000
age 140 days0.500000
harlan sprague dawley0.500000
LOWER IN harlan spague dawley0.500000
a/j0.500000
LOWER IN a/j0.500000
LOWER IN age 24 weeks0.500000
age 24 weeks0.500000
age 50-70 years0.500000
scalp0.500000
baoding city prefecture0.500000
low atmospheric pollution0.500000
LOWER IN baoding city prefecture0.500000
LOWER IN high atmospheric pollution0.500000
high atmospheric pollution0.500000
LOWER IN low atmospheric pollution0.500000
skin of cheek0.500000
LOWER IN scalp0.500000
lactobacillus plantarum0.500000
LOWER IN lactobacillus plantarum0.500000
cba/caj0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
upper leg skin0.500000
inner thigh0.500000
castor bean tick0.500000
age 13-15 years0.500000
birth during last 6 months0.500000
LOWER IN birth in over 6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
birth in over 6 months0.500000
LOWER IN birth during last 6 months0.500000
Fraction of annotations for the query sequences containing the term
TermScore
female0.916968
feces0.548736
homo sapiens0.534296
adult0.418773
united states of america0.361011
research facility0.335740
mus musculus0.241877
mouse0.241877
china0.162455
pregnancy0.129964
vagina0.101083
skin0.093863
LOWER IN female0.083032
c57bl/60.079422
male0.075812
LOWER IN male0.075812
age 25-45 years0.072202
whole body0.068592
body proper0.064982
panama0.064982
control0.061372
germany0.050542
caecum0.046931
LOWER IN control0.043321
c57bl/6j0.043321
captive0.043321
state of california0.039711
female organism0.039711
balb/c0.039711
diet0.036101
gestational diabetes0.036101
janvier labs0.036101
state of oregon0.032491
shanghai district0.032491
skin of cheek0.032491
south korea0.028881
state of arizona0.028881
phoenix0.028881
canada0.028881
indonesia0.028881
municipality of yogyakarta0.028881
infant0.028881
saliva0.025271
obesity0.025271
scalp0.025271
ovariectomy0.025271
age 18 weeks0.025271
macaca mulatta0.021661
monkey0.021661
rhesus macaque0.021661
zoological garden0.021661
san diego zoo0.021661
culicoides <genus>0.021661
biting midge0.021661
sand fly0.021661
mosquito0.021661
oral cavity0.021661
high fat diet0.021661
baoding city prefecture0.021661
dalian city prefecture0.021661
mouse chow0.021661
guangzhou city prefecture0.021661
fourth decade human stage0.021661
fifth decade human stage0.021661
egypt0.021661
ismailia0.021661
rumen0.021661
ovis aries0.021661
nanjing city prefecture0.021661
digesta0.021661
sheep0.021661
tanzania0.021661
pemba island0.021661
south africa0.021661
rattus norvegicus0.021661
rat0.021661
age 38 weeks0.021661
high sugar diet0.021661
jackson laboratories0.018051
age 2 months0.018051
age 9 weeks0.018051
dentition0.018051
third trimester0.018051
city0.018051
rural community0.018051
italy0.018051
turin township0.018051
human adult stage0.018051
state of new york0.014440
mus musculoides0.014440
nyulmc0.014440
nod/shiltj (no. 001976, jackson labs)0.014440
nod mouse0.014440
amsterdam0.014440
tongue0.014440
sus scrofa0.014440
pig0.014440
austria0.014440
graz city district0.014440
obese body mass index status0.014440
Exp. ID User ID Description Date Region Flag Sequences
176amnonhigh freq. in skin of hairless mice (dominant united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse)2019-01-10v4No1 / 1
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in homo sapiens female vagina adult indonesia municipality of yogyakarta )2021-01-02v3No1 / 1
736amnon high in control compared to parasitic helminthiasis infectious disease helminthiasis in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 1
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female obesity adult china shanghai district 2028-03-17v3No1 / 2
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 3
203amnon high in male compared to female in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth 2017-10-01v4No1 / 3
231amnonhigher in female compared to male in dog genitalia ( high in female compared to male in united states of america reproductive system reproductive organ canis lupus familiaris dog genitalia )2017-11-02v4No1 / 3
203amnon high in female compared to male in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth 2017-10-01v4No1 / 4
528amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2019-07-14v1No1 / 5
598amnon high in male compared to female in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
598amnon high in female compared to male in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 5
423amnon high in female compared to male in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 6
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 7
217amnondominant feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
167amnondominant feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
674amnondominant female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 8
819amnondominant homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 8
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 8
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
535amnon high in dysplasia of cervix compared to control in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 9
456amnondominant tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 9
693amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 9
819amnondominant homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
10amnon high in female compared to male in feces homo sapiens toronto 2016-10-27v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
595amnon high in male compared to female in switzerland whole body ixodes ricinus castor bean tick 2020-03-16v4No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 10
724amnondominant homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 10
735amnondominant female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 10
740amnon high in male male organism compared to female female organism in cloaca ecuador galapagos islands alimentary part of gastrointestinal system amblyrhynchus cristatus cloacal swab marine iguana 2021-02-08v4No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 10
10amnon high in male compared to female in feces homo sapiens toronto 2016-10-27v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 11
191amnondominant homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 11
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 11
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 11
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
861amnondominant feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 11
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
611amnon high in male compared to female in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
861amnondominant feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
7amnondominant homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 14
560amnondominant united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
693amnondominant feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
560amnondominant united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 15
674amnondominant female, body proper, panama, whole body, culicoides <genus>, biting midge, culicoides helicaniae2020-09-28v4No1 / 15
674amnondominant female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 15
456amnondominant united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
456amnoncommon tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
819amnoncommon homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
723amnoncommon homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 15
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 15
528amnondominant homo sapiens, united states of america, female, pregnancy, vagina2019-07-14v1No1 / 16
310amnondominant feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
674amnondominant female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
717amnon high in male male organism compared to female female organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
874amnondominant homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 18
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
736amnondominant feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 20
697amnondominant female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 20
188amnondominant feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
674amnondominant female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v3No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 22
819amnoncommon homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 22
219amnonhigh freq. in mother mice feces (dominant feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
674amnondominant female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
674amnoncommon female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 26
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
693amnon high in polycystic ovary syndrome compared to control in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
191amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
740amnon high in female female organism compared to male male organism in cloaca ecuador galapagos islands alimentary part of gastrointestinal system amblyrhynchus cristatus cloacal swab marine iguana 2021-02-08v4No1 / 31
611amnon high in female compared to male in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 33
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
528amnon high in african american african compared to caucasian in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, biting midge, culicoides helicaniae2020-09-28v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
528amnon high in caucasian compared to african american african in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in homo sapiens female vagina adult indonesia municipality of yogyakarta )2021-01-02v3No1 / 38
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
757amnon high in male compared to female in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 44
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
211amnon high in male compared to female in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 47
640amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 52
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
423amnon high in male compared to female in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
644amnon high in male compared to female in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 58
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to high fat diet western diet very high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 60
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
874amnoncommon homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 67
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
896amnon high in starch diet compared to glucose diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 70
819amnon high in scalp compared to skin of cheek in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 70
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 73
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
861amnoncommon feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 73
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 85
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 94
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
217amnoncommon feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
861amnoncommon feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 113
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
458amnoncommon in mice strains from jackson laboratories (common feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 129
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 147
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
456amnoncommon united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 167
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
458amnoncommon in mice strains from harlan sprague dawley (common feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 184
188amnoncommon feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 185
861amnon high in city soweto urban community compared to rural community bushbuckridge local municipality peri-urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 185
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
896amnon high in glucose diet compared to starch diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 238
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 242
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
861amnon high in rural community bushbuckridge local municipality peri-urban community compared to city soweto urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 289
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
456amnon high in caecum compared to tongue in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 338
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
560amnoncommon united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 373
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to balb/c a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 380
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
560amnoncommon united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros ceratotherium simum simum in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 656
560amnon high in ceratotherium simum white rhinoceros ceratotherium simum simum compared to rhinoceros unicornis greater one-horned rhinoceros in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 677
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
78amnon high in female compared to male in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 811
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684

Problems / suggestions? Please email info AT dbbact DOT org