Summary for ontology term: fifth decade human stage

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGATGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.307692
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTGAGGCTAGAGTGCAGGAGGGGTGAGTGGAATTCCTAG0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.230769
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTTTAAGATTAAAGCCCGGGGCTCAACTCCGGTAAGTCTTAAAAACTGGTAGACTTGAGTACGGTAGAGGCAAACGGAATTTCTAGT0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCTGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.230769
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.230769
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAGATTAAGTTAGTTGTGAAAGCCCTTGGCTTAACTGAGGAATTGCAACTAAAACTGGTTTTCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.230769
d__BacteriaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACGCGCAAGTCTGCGGTCAAATTCCGGGGCTCAACCCCGGACCGCCGTGGAAACTGTGCGACTAGAGTGGGCGAGAGGCATGCGGAATGCGCGGT0.230769

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAATAAGTTAGTTGTGAAATCCCCATGCTTAACATGGGAACTGCAACTAAAACTGTTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.600000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTAGGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Christensenellaceae;g__ChristensenellaTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTCATGTAAGTCAGATGTGAAAGACCCGGGCTTAACCCGGGGGCTGCATTTGAAACTGTGTGACTTGAGTACAGGAGAGGGAAGTGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATGCAAGTTGAATGTTTAAACTATCGGCTCAACTGATAGTCGCGTTCAAAACTGCAACTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAACAGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTGATCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCGCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__AnaerofustisTACGTAGGGAGCAAGCGTTGTCCGGATTCACTGGGCGTAAAGAGCACGTAGGCGGTTAATTAAGTCAGGTGTGAAAGTTTTCGGCTCAACCGGAAAAGTGCACTTGAAACTGGATAACTTGAGTATCGGAGAGGTAAGCGGAATTCCTAG0.400000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCTTTTTAAGTCTGGAGTGAAAGCCCCTTTTTCAAGGAGGGGAGTGCTTTGGAGACTGGAGAGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__EubacteriumTACGTAGGGGACAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTCTATTAAGTCTGATGTGAAAGGTACCGGCTCAACCGGTGAAGTGCATTGGAAACTGGTAGACTTGAGTATTGGAGAGGCAAGTGGAATTCCTAG0.400000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTTCTCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGAAAACTACCAAGCTAGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.352941
d__BacteriaTACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTTAAAGTCGCCAAAAACTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.352941
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCTTGCTAGAGTTCGAGTGAGGTATGCGGAATGTGTTGT0.352941
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGACAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGAAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.352941
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCCG0.352941
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__CloacibacillusTACGTAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGCAGGCTGGCCGTTAAGTCTGTCGTCAAAGGCGGAGGCTCAACCTCCGTTCTACGATAGATACTGTCGGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.352941
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGATGGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGACTGCATTTGAAACTGTTGTTCTTGAGTGAGGTAGAGGTAAGCGGAATTCCTGG0.352941
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTTTAAGATTAAAGTCCGGGGCTCAACTCCGGTAAGTCTTAAAAACTGGTAGACTTGAGTACGGTAGAGGCAAACGGAATTTCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGAGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.333333

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
131amnonpositively correlated with age (30-80 years) ( high in age human late adulthood stage compared to fourth decade human stage fifth decade human stage in feces homo sapiens south korea )2017-04-16v4No1 / 1
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org