Summary for ontology term: filtered 0.2um

Number of annotations with term: 36

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.028571
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGACGGTGGCTCAACCATCGTTAGCCATTGAAACTGGTAGTCTTGAGTGCAGACAGGGATGCTGGAACTCGTGGT0.028571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.028571
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Bdellovibrionales;f__Bacteriovoracaceae;g__PeredibacterTACGAAGGGTCCAAGCGTTGTTCGGAATCATTGGGCGTAAAGCGCGCGCAGGCGGATCAGCAAGTCAGATGTGAAATCTCGAAGCTCAACTTCGAAACTGCGTCTGAAACTGCTAGTCTAGAGTGTCGGAGGGGGTAGGGGAATTTCACG0.028571
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGAGGCTCAACCTCGGACCTGCAGTGGGTACGGGCAAACTAGAGTGCGGTAGGGGAGATGGGAATTCCTGG0.028571
d__BacteriaTACAGAGGTGGCAAGCGTTGTTCGGATTTATTGGGCGTAAAGGGTCCGTAGGCGGCCTGGAAAGTTGGATGTGAAATCCCACAGCTTAACTGTGGAACTGCATTCAAAACTTCTAGGCTCGAGTGTGATAGGGGTAAAGGGAATTCCCGG0.028571
d__Bacteria;p__Parcubacteria;g__Parcubacteria_genera_incertae_sedisTACGAGTGCCTCAAGCGTTATCCGGAATCATTGGGCGTAAAGGTTGTGTAGGTGGTCATATTAGTCTCTTGTTAAATTCTTCGGCTTAACCGGGGGCATGCAAGGGAAACGGTATGACTAGAGGATGCGAGGGGTCTGCGGAACTCATAG0.028571
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__CytophagaceaeTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGCAGGTGGTTTATTAAGTCAGTGGTGAAAGACGGTCGCTCAACGATTGCAGTGCCATTGAAACTGGTAGACTTGAGTAAAGTAGAGGTGGGCGGAATTGATAG0.028571
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.028571
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.028571

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__DesulfosporosinusTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGATAGTTAAGTCCGGTGTGAAAGATCAGGGCTCAACCCTGAGAGTGCATCGGAAACTGGTTATCTTGAGGACAGGAGAGGAAAGTGGAATTCCACG0.333333
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.333333
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGATATTTAAGTCAGATGTGAAAACTGGCGGCTCAACCGTGAGACTGCATCTGATACTGGATATCTTGAGGGTAAGAGAGGGCAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 1TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACG0.333333
d__BacteriaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTCGAAAAGTCCACTGTTAAAAATTGAGGCTTAACCTCAAAGATGCCGTGGAAACTTTCAAACTAGAGTATGGTAGGGGTAGAGGGAATTTCCAG0.333333
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCGCCTAAGTCAGTTGTGAAATACCCCGGCTCAACCGGGGGGGTGCGATTGATACTGGGCGGCTCGAGTAACAGCGAGGTTGGCGGAATTGACGG0.333333
d__BacteriaTACGTAGGGGGCTAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCCAGATAGGTCTGCTGTGAAAACTCGAGGCTCAACCTCGAGCTGTCGGCGGAAACCATTTGGCTAGAGTCCGGAAGAGGAAAGTGGAATTCCTGG0.333333
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__ProsthecobacterTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTGCGTAGGTGGCGTGGTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATCCGATACTACCATGCTAGAGTACTGAAGAGGTGACTAGAATTCTCGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAAGGTCATTGGAAACTGAAGGGCTTGAGTACAGAAGAGGAAAGCGGAATTCCACG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGAGGAAACTCTGAACCAGCCATGCCGCGTGAAGGATGACGGCCCTATGGGTTGTAAACTTCTTTTATATGGGAAGAAACTTATCTACGTGTAGATAACTGACGGTACCATACGAATAAGGATCGGCTAACT0.434783
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGTCAATGGAGGCAACTCTGAACCAGCCATGCCGCGTGAAGGATGACGGCCCTATGGGTTGTAAACTTCTTTTATATGGGAAGAAACTTATCTACGTGTAGATAACTGACGGTACCATACGAATAAGGATCGGCTAACT0.434783
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTGGGGAATCTTAGACAATGGGGGCAACCCTGATCTAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTCGTAAAGCTCTTTCGCCTGTGATGATAATGACAGTAGCAGGTAAAGAAACCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.434783
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family II;g__GpIIaTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAGATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGG0.372881
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGAGGCCACTCTGATCCAGCCATGCCGCGTGCAGGAAGACTGCCCTATGGGTTGTAAACTGCTTTTATACAGGAAGAAACTGCGCTACGAGTAGCGTACTGACGGTACTGTAAGAATAAGGATCGGCTAACT0.363636
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGTCGAAAGACTGATCCAGCCATGCCGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATACGGGAAGAAAAACACCTACGTGTAGGTGACTGACGGTACCGTAAGAATAAGGACCGGCTAACT0.355556
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATCTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGAAGAAGGCCTTAGGGTTGTAAAGCTCTTTCAGGGGTGAGGATTATGACAGTAACCCCAGAAGAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.325581
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurimonasTGAGGAATATTGCACAATGGGGGAAACCCTGATGCAGCAACGCCGCGTGGAGGATGACGCATTTCGGTGTGTAAACTCCTTTTATGAGTCAAGAAAATGACGGTAGCTCATGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.325581
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAACTCTTTCGTCAGGGAAGATAATGACGGTACCTGAAGAAGAAGATCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.325581
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATGCCGCGTGTGTGATGAAGGCCTTAGGGTTGTAAAGCACTTTCAATGGTGAAGATGATGACGGTAACCATAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.325581

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
filtered 0.2um0.833333
depth (water) 1m0.666667
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
tributary0.500000
free floating0.500000
koshi river0.500000
LOWER IN filtered 2.7um0.500000
filtered 2.7um0.500000
lower mississippi river0.500000
LOWER IN higher mississippi river0.500000
LOWER IN lower mississippi river0.500000
uppper mississippi river0.500000
river amazon0.500000
lago grande do curuai0.500000
normal weather0.500000
LOWER IN tropical storm0.500000
okinawa islands0.500000
tropical storm0.500000
LOWER IN normal weather0.500000
LOWER IN storm0.500000
LOWER IN typhoon0.500000
storm0.500000
typhoon0.500000
depth 0-20cm0.333333
ice0.333333
LOWER IN depth 0-20cm0.333333
nepal0.333333
LOWER IN particles0.333333
particles0.333333
LOWER IN free floating0.333333
LOWER IN filtered 0.2um0.333333
upper mississippi river0.333333
near shore0.333333
depth (water) 10cm0.250000
mississippi river0.250000
downstream0.250000
LOWER IN upstream0.250000
upstream0.250000
LOWER IN downstream0.250000
LOWER IN particle bound0.250000
lake water0.250000
particle bound0.250000
surface0.200000
glacier0.200000
LOWER IN surface0.200000
river0.166667
fresh water0.103448
surface water0.083333
autumn0.076923
LOWER IN autumn0.076923
sweden0.066667
japan0.062500
water0.054545
brazil0.052632
summer0.043478
LOWER IN summer0.043478
sea water0.028571
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
filtered 0.2um0.944444
water0.444444
fresh water0.444444
free floating0.388889
surface water0.388889
sea water0.388889
near shore0.388889
japan0.388889
okinawa islands0.388889
river0.333333
depth (water) 1m0.333333
united states of america0.222222
mississippi river0.222222
normal weather0.222222
summer0.194444
autumn0.194444
glacier0.166667
sweden0.166667
ice0.166667
nepal0.111111
depth (water) 10cm0.111111
koshi river0.111111
brazil0.111111
lake water0.111111
river amazon0.111111
lago grande do curuai0.111111
surface0.083333
depth 0-20cm0.083333
subsurface0.083333
depth 20-100cm0.083333
downstream0.083333
lower mississippi river0.083333
upstream0.083333
tropical storm0.083333
storm0.083333
typhoon0.083333
tributary0.055556
LOWER IN filtered 2.7um0.055556
filtered 2.7um0.055556
LOWER IN free floating0.055556
LOWER IN filtered 0.2um0.055556
uppper mississippi river0.055556
LOWER IN normal weather0.055556
LOWER IN subsurface0.027778
LOWER IN depth 20-100cm0.027778
LOWER IN surface0.027778
LOWER IN depth 0-20cm0.027778
LOWER IN particles0.027778
particles0.027778
LOWER IN upstream0.027778
LOWER IN higher mississippi river0.027778
upper mississippi river0.027778
LOWER IN downstream0.027778
LOWER IN lower mississippi river0.027778
LOWER IN particle bound0.027778
particle bound0.027778
LOWER IN tropical storm0.027778
LOWER IN storm0.027778
LOWER IN typhoon0.027778
LOWER IN autumn0.027778
LOWER IN summer0.027778
Exp. ID User ID Description Date Region Flag Sequences
807amnondominant surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 8
534amnondominant river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 10
807amnondominant surface water, sea water, autumn, near shore, filtered 0.2um, storm, japan, okinawa islands, typhoon2021-06-20v3No1 / 12
534amnondominant river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 13
807amnondominant surface water, sea water, autumn, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 14
807amnondominant surface water, sea water, summer, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 14
807amnon high in normal weather compared to tropical storm in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 16
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 17
807amnonlower during typhoon with red soil pollution compared to normal weather ( high in normal weather compared to storm typhoon in surface water sea water autumn near shore filtered 0.2um japan okinawa islands )2021-06-20v3No1 / 17
763amnondominant glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 18
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 19
733amnondominant water, fresh water, brazil, free floating, depth (water) 1m, filtered 0.2um, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 21
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
733amnon high in free floating filtered 0.2um compared to filtered 2.7um particle bound in water fresh water brazil depth (water) 1m lake water river amazon lago grande do curuai 2021-01-17v3No1 / 46
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 74
807amnon high in autumn compared to summer in surface water sea water near shore filtered 0.2um japan okinawa islands normal weather 2021-06-20v3No1 / 78
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
733amnon high in filtered 2.7um particle bound compared to free floating filtered 0.2um in water fresh water brazil depth (water) 1m lake water river amazon lago grande do curuai 2021-01-17v3No1 / 82
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
807amnon high in summer compared to autumn in surface water sea water near shore filtered 0.2um japan okinawa islands normal weather 2021-06-20v3No1 / 109
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 142
534amnoncommon river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
733amnoncommon water, fresh water, brazil, free floating, depth (water) 1m, filtered 0.2um, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 210
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 219
807amnoncommon surface water, sea water, autumn, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 240
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in surface water sea water autumn near shore filtered 0.2um japan okinawa islands )2021-06-20v3No1 / 318
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 335
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
807amnoncommon surface water, sea water, autumn, near shore, filtered 0.2um, storm, japan, okinawa islands, typhoon2021-06-20v3No1 / 447
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 652
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 905
807amnon high in tropical storm compared to normal weather in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 1191
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 2266

Problems / suggestions? Please email info AT dbbact DOT org