Summary for ontology term: finland

Number of annotations with term: 26

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATCGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGTGGTCTTGAGTGAGCGAGAAGCAGGCGGAATGCGTGGT0.130435
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.130435
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.086957
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGCAGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTAACTTAAGCGCGGGGTTTAAGGCAATGGCTTAACCATTGTTCGCCCTGCGAACTGGGATACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCAGAGCAAGTCAGGCGTGAAAGCCATGGGCTTAACCCATGAACTGCGCTTGAAACTGTTCTGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTACGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGCAGTCAAGTCAGACGTGAAATCTATGGGCTTAACCCATAGTCTGCGTTTGAAACTGAATGTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCCGG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGATTGGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTAGTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.086957

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGAAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCGATCAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGATTGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAGACCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGGTAAACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.600000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.600000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGTTTATTAGGTCTATGGTTTAATTCCGAAGCTTAACTTCGGTTCGCCATAGAAACCGATTTACTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATGACTGGGTGTAAAGGGAGCGTAGGCGGGATGGCAAGTCAGATGTGAAACCTGAGGGCTCAACCTTCAGACTGCATTTGAAACTGCTGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SlackiaTACGTAGGGGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGCGCGCGCAGGCGGGCTTTCAAGCGGCGGCGTCGAAGCCGGGGGCTCAACCCCCGGAAGCGCCCCGAACTGGAAGCCTCGGATGCGGCAGGGGGAGGCGGAATTCCCGG0.600000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SenegalimassiliaTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGAGCGCTAAGCGGGACCTCTAACCCGAGGGCTCAACCCCCGGCCGGGTCCCGAACTGGCGCTCTCGAGTGCGGTAGGGGAGAGCGGAATTCCCGGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGGCCTTGAGTACAGTTGAGGTAGGCGGAATTCGTGG0.322581
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATCGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGTGGTCTTGAGTGAGCGAGAAGCAGGCGGAATGCGTGGT0.242424
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTTTGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGAATGCTTTGGAAACTGTAGAACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.222222
d__BacteriaCACGGAGAGCACGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGCTGCTGTTGTTAATTTTTAACCGAAATCGCGGAGTGTTCCTATGCGCTGGTTTTTTAGAAGATATAGCTGGTGTTAAAGATAGGTTGGGGCAATTTCC0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATCGCAAGTCAGATGTGAAAACTGGAGGCTCAACCTCCGGCCTGCATTTGAAACTGTGGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.214286
d__BacteriaGACGGAGAGCGCGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGTAGTTTTTGATAATTTTTAACTAAAAACGCAGAGTGTTCCTATGCGCTAGTTTTTTTAAAGATCAAACTAGTACTGATTAGAGGTTGGGGCAATTTCC0.214286
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGTCAGCTGTGAAAGTCCGCGGCTTAACCGTGGAATTGCAGTTGAAACTGGAGGCCTTGAGTGCACACAGGGATGCCGGAATTCATGG0.210526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCCGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGATTGCTTTTGAAACTGTCAGGCTCGATTGCCGGAGAGGTAAGTGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTAAACTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.187500
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.181818

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
finland0.857143
age < 3 years0.666667
high fat diet + polydextrose0.500000
polydextrose0.500000
c57bl/6ncrl0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
lapland0.500000
LOWER IN lapland0.500000
LOWER IN finland0.428571
estonia0.333333
LOWER IN estonia0.333333
depth 0-5cm0.333333
13-year-old human stage0.250000
snow0.250000
juvenile organism0.166667
LOWER IN india0.142857
india0.142857
breast milk0.142857
kingdom of norway0.125000
LOWER IN kingdom of norway0.125000
LOWER IN state of colorado0.111111
state of colorado0.111111
obsolete_juvenile stage0.100000
russia0.100000
LOWER IN russia0.100000
LOWER IN high fat diet0.083333
high fat diet0.083333
infant0.076923
LOWER IN 1-year-old human stage0.066667
1-year-old human stage0.066667
sweden0.066667
LOWER IN sweden0.066667
under-1-year-old human stage0.052632
LOWER IN under-1-year-old human stage0.052632
age0.047619
male0.030303
mouse0.017544
mus musculus0.015873
homo sapiens0.014760
feces0.012739
research facility0.006803
LOWER IN united states of america0.004049
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
finland0.846154
feces0.769231
homo sapiens0.615385
infant0.384615
age < 3 years0.307692
research facility0.230769
mus musculus0.230769
male0.230769
mouse0.230769
c57bl/6ncrl0.230769
juvenile organism0.153846
obsolete_juvenile stage0.153846
13-year-old human stage0.153846
LOWER IN finland0.153846
depth 0-5cm0.153846
snow0.153846
high fat diet + polydextrose0.115385
polydextrose0.115385
high fat diet0.115385
kingdom of norway0.115385
sweden0.115385
lapland0.115385
age0.076923
breast milk0.076923
LOWER IN high fat diet0.038462
LOWER IN high fat diet + polydextrose0.038462
LOWER IN polydextrose0.038462
LOWER IN india0.038462
india0.038462
under-1-year-old human stage0.038462
LOWER IN 1-year-old human stage0.038462
1-year-old human stage0.038462
LOWER IN under-1-year-old human stage0.038462
russia0.038462
LOWER IN russia0.038462
estonia0.038462
LOWER IN estonia0.038462
LOWER IN united states of america0.038462
LOWER IN state of colorado0.038462
united states of america0.038462
state of colorado0.038462
LOWER IN kingdom of norway0.038462
LOWER IN sweden0.038462
LOWER IN lapland0.038462
Exp. ID User ID Description Date Region Flag Sequences
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
457amnondominant feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 15
511amnondominant kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 15
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
457amnondominant feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
511amnon high in united states of america state of colorado compared to kingdom of norway sweden finland lapland in depth 0-5cm snow 2019-03-20v4No1 / 24
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 97
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
457amnoncommon feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 168
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 186
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567

Problems / suggestions? Please email info AT dbbact DOT org