Summary for ontology term: first pregnancy

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGACTTTAAGTCAGATGTGAAAGGCGGGGGCTTAACCCCCGAACTGCATTTGAAACTGGAGTTCTTGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATAGAAACTATTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTGGAAACTGTCATACTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTCGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAGCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAGCTAAAACTACTATTCTTGAGTGCGGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTTTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTGGAAACTGTCAAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACATAGGGGGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGCAAGTTAGTTGTGAAAGCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATCTTTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGTGCAAGTCTGATGTGAAAGCCCGGGGCTTAACCCCGGGACTGCATTGGAAACTGTATTGCTTGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGATGACAAGTTAGTTGTGAAAGCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTGTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGTCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCATGCAGGCGGCTCATTACGCGTGGCGTGAAAGCCCCCGGCTTAACCGGGGAGGGTCGTCGCGTACGGGTGAGCTTGAGGGTATCAGGGGTTGGTAGAATTCCCGG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATTCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGGCTGTTAAGTCAGCGGTGAAATTTTGTGGCTCAACCATAAAACTGCCGTTGATACTGGCGGTCTTGAGTGACGTCGGGGGAGGCGGAATGTGACG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Alcaligenaceae;g__OligellaTACATAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGCTAAGCAAGAACGGTGTGAAATCCCGGGGCTCAACCTCGGAACTGCACTATTAACTGCTTAGCTAGAGTATGTCAGAGGGGGGTGGAATTCCGCG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGAGTAGGCGGGACTGCAAGTCCGTTGTTAAATCTATCGGCTCAACCGGTAGCTGCGGCGGAAACTGTAGTTCTTGAGTGAAGTAGAGGCAGGCGGGATTCCTAGT0.500000
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCTGTTTTTATTGGGCCTGAAGCGTTCGTAGCCGGTTTGATAAGTCTCTGGTGAAATCTTGTAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGGCTTGAGATCGGGAGAGGTTAGAGGTACTCCTG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Microbacteriaceae;g__HerbiconiuxTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACTGGAGGCTCAACCTCCAGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATTCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGGCTGTTAAGTCAGCGGTGAAATTTTGTGGCTCAACCATAAAACTGCCGTTGATACTGGCGGTCTTGAGTGACGTCGAGGGAGGCGGAATGGGACG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGCGGGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCCCGCTTGAGTGCGGTAGAGGCAGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTGTCTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGACTTTAAGTCAGATGTGAAAGGCGGGGGCTTAACCCCCGAACTGCATTTGAAACTGGAGTTCTTGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTCGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAGCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAGCTAAAACTACTATTCTTGAGTGCGGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTTTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTGGAAACTGTCAAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGCTGGGCTCGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGTCAGATGTGAAATACCGGAGCTCAACTCCGGGACTGCATTTGAAACTGTCCGGCTAGAGTGCAGGAGAGGCAGGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCGATACAAGTCAGGCGTGAAATGCAGGGGCTTAACCTCTGACGTGCGTTTGAAACTGTATGGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGACGCAGACGGCGATGCAAGTCTGAAGTGAAAACCCACGGCTCAACTGTGGAATTGCTTTGGAAACTGTATTGCTTGAGTGCTGGAGAGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MitsuokellaTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAGAGTAAGTCTATCCTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATGGAAACTATTCTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTTTGCAAGCTTGGTGTGAAATGCCGGAGCTTAACTCCGGAATTGCGTTGAGAACTGCATGACTAGAGTCACTGAGGGGCAATCAGAATTCTAGG0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
commonwealth of pennsylvania0.181818
pregnancy0.142857
adult organism0.133333
female organism0.133333
sus scrofa0.117647
pig0.117647
research facility0.012270
united states of america0.007692
feces0.005780
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
commonwealth of pennsylvania0.100000
pregnancy0.076923
adult organism0.071429
female organism0.071429
sus scrofa0.062500
pig0.062500
research facility0.006173
united states of america0.003861
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
commonwealth of pennsylvania1.000000
pregnancy1.000000
feces1.000000
adult organism1.000000
research facility1.000000
united states of america1.000000
female organism1.000000
sus scrofa1.000000
pig1.000000
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000

Problems / suggestions? Please email info AT dbbact DOT org