Summary for ontology term: fourth decade human stage

Number of annotations with term: 30

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGATGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCTGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__CoprococcusTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGTAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTATGCAGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCCAG0.160000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAATAAGTTAGTTGTGAAATCCCCATGCTTAACATGGGAACTGCAACTAAAACTGTTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.428571
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__HungatellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTTGACTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CoprobacillusTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCAATAGAGGTCTGCGGTGAAAGCCTGAAGCTAAACTTCAGTAAGCCGTGGAAACCAAATAGCTAGAGTGCAGTAGAGGATCGTGGAATTCCATGT0.428571
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.428571
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.428571
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTAGGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.285714

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.238095
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTTCTCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGAAAACTACCAAGCTAGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.206897
d__BacteriaTACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTTAAAGTCGCCAAAAACTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.206897
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCTTGCTAGAGTTCGAGTGAGGTATGCGGAATGTGTTGT0.206897
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGACAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGAAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.206897
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCCG0.206897
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__CloacibacillusTACGTAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGCAGGCTGGCCGTTAAGTCTGTCGTCAAAGGCGGAGGCTCAACCTCCGTTCTACGATAGATACTGTCGGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.206897
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGATGGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGACTGCATTTGAAACTGTTGTTCTTGAGTGAGGTAGAGGTAAGCGGAATTCCTGG0.206897
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTTTAAGATTAAAGTCCGGGGCTCAACTCCGGTAAGTCTTAAAAACTGGTAGACTTGAGTACGGTAGAGGCAAACGGAATTTCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGAGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
fourth decade human stage0.888889
fifth decade human stage0.521739
LOWER IN fourth decade human stage0.296296
multiple sclerosis0.250000
LOWER IN 65-79 year-old human stage0.222222
65-79 year-old human stage0.222222
LOWER IN fifth decade human stage0.210526
oslo0.210526
guangzhou city prefecture0.200000
third decade human stage0.166667
systemic lupus erythematosus0.142857
zhejiang province0.133333
kingdom of norway0.129032
auckland city0.125000
LOWER IN age >940.117647
LOWER IN tenth decade human stage0.117647
age >940.117647
tenth decade human stage0.117647
oesophageal brush0.117647
LOWER IN ninth decade human stage0.111111
ninth decade human stage0.111111
LOWER IN multiple sclerosis0.111111
new zealand0.105263
esophagus0.105263
jiangsu province0.076923
south korea0.074074
adult0.066232
soldiers0.062500
LOWER IN soldiers0.062500
age 3-60.062500
age 8-120.062500
LOWER IN age 3-60.062500
LOWER IN age 8-120.062500
LOWER IN third decade human stage0.058824
LOWER IN systemic lupus erythematosus0.058824
age 1 year0.058824
LOWER IN age 1 year0.058824
young adult stage0.057143
LOWER IN young adult stage0.057143
6-12 year-old child stage0.057143
LOWER IN 6-12 year-old child stage0.057143
age0.055556
australia0.052632
homo sapiens0.050360
human late adulthood stage0.050000
LOWER IN human late adulthood stage0.050000
2-5 year-old child stage0.048780
LOWER IN 2-5 year-old child stage0.048780
feces0.037450
infant0.035714
LOWER IN infant0.035714
china0.033994
child0.030303
LOWER IN child0.030303
female0.029412
LOWER IN adult0.020725
control0.020000
LOWER IN control0.018605
Fraction of dbbact annotations with this term covered by the query
TermScore
fourth decade human stage1.000000
auckland city1.000000
fifth decade human stage0.750000
LOWER IN 65-79 year-old human stage0.666667
65-79 year-old human stage0.666667
LOWER IN fourth decade human stage0.571429
soldiers0.500000
LOWER IN age >940.500000
LOWER IN fifth decade human stage0.500000
LOWER IN tenth decade human stage0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
third decade human stage0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
oesophageal brush0.500000
oslo0.500000
LOWER IN ninth decade human stage0.333333
ninth decade human stage0.333333
multiple sclerosis0.333333
LOWER IN multiple sclerosis0.333333
new zealand0.250000
esophagus0.250000
LOWER IN third decade human stage0.250000
systemic lupus erythematosus0.250000
LOWER IN systemic lupus erythematosus0.250000
age 1 year0.250000
LOWER IN age 1 year0.250000
young adult stage0.200000
LOWER IN young adult stage0.200000
6-12 year-old child stage0.200000
LOWER IN 6-12 year-old child stage0.200000
guangzhou city prefecture0.200000
kingdom of norway0.125000
human late adulthood stage0.100000
LOWER IN human late adulthood stage0.100000
zhejiang province0.100000
2-5 year-old child stage0.090909
LOWER IN 2-5 year-old child stage0.090909
jiangsu province0.090909
south korea0.083333
age0.047619
australia0.043478
infant0.038462
LOWER IN infant0.038462
adult0.034682
child0.027778
LOWER IN child0.027778
homo sapiens0.025830
feces0.019108
china0.017442
female0.015873
LOWER IN adult0.011561
control0.010811
LOWER IN control0.010811
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces0.933333
fourth decade human stage0.800000
adult0.733333
china0.666667
fifth decade human stage0.400000
LOWER IN fourth decade human stage0.200000
zhejiang province0.200000
multiple sclerosis0.200000
female0.200000
guangzhou city prefecture0.200000
LOWER IN 65-79 year-old human stage0.133333
LOWER IN fifth decade human stage0.133333
65-79 year-old human stage0.133333
control0.133333
kingdom of norway0.133333
oslo0.133333
LOWER IN adult0.100000
third decade human stage0.100000
systemic lupus erythematosus0.100000
LOWER IN age >940.066667
LOWER IN ninth decade human stage0.066667
LOWER IN tenth decade human stage0.066667
age >940.066667
ninth decade human stage0.066667
tenth decade human stage0.066667
new zealand0.066667
auckland city0.066667
age0.066667
south korea0.066667
esophagus0.066667
australia0.066667
oesophageal brush0.066667
jiangsu province0.066667
LOWER IN control0.066667
LOWER IN multiple sclerosis0.066667
soldiers0.033333
young adult stage0.033333
LOWER IN soldiers0.033333
LOWER IN young adult stage0.033333
human late adulthood stage0.033333
LOWER IN human late adulthood stage0.033333
child0.033333
age 3-60.033333
age 8-120.033333
2-5 year-old child stage0.033333
6-12 year-old child stage0.033333
LOWER IN child0.033333
LOWER IN age 3-60.033333
LOWER IN age 8-120.033333
LOWER IN 2-5 year-old child stage0.033333
LOWER IN 6-12 year-old child stage0.033333
LOWER IN third decade human stage0.033333
LOWER IN systemic lupus erythematosus0.033333
infant0.033333
age 1 year0.033333
LOWER IN infant0.033333
LOWER IN age 1 year0.033333
Exp. ID User ID Description Date Region Flag Sequences
131amnonpositively correlated with age (30-80 years) ( high in age human late adulthood stage compared to fourth decade human stage fifth decade human stage in feces homo sapiens south korea )2017-04-16v4No1 / 1
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 2
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 4
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 11
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
849amnondominant feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 17
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
870amnondominant feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
870amnoncommon feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 71
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org