Summary for ontology term: germany

Number of annotations with term: 268

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.015267
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.015267
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCGTAGGCGGGGGGTCAAATCCCGGGGCTCAACCCCGGTCCGCCCCCCGAACCCCGCGGCTCGGGTCCGGTAGGGGAGGGTGGAATTCCCGGT0.015267
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.015267
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTCTGTTAAGTCGGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.011450
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.011450
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.011450
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGATGCGTAGGCGGATATTTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.011450
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGATTCTTAAGTGAGATGTGAAATACCCGGGCTTAACTTGGGTGCTGCATTTCAAACTGGGAATCTAGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.011450
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegamonasTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAATTAAGCGGATCTTAAAAGTGCGGGGCTCAACCTCGTGAGGGGGTCCGAACTGATTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.011450

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.375000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.375000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGTCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTAAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCAGGGGCTCAACCCCTGGACTGCATTGGAAACTGTCAGTCTTGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGAGAAACTTGAGTGCAGGAGAGGAGAGTAGAATTCCTAGT0.375000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCCTTTTAAGTCGGAAGTGAAATTTCGGGGCTCAACCCCGGAGCTGCTACCGAAACTGAGAGGCTAGAGTGTGGGAGAGGAAAGTGGAACTTTGAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCACAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCTGGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.375000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTTGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCGCCGGCTAACTACGTGCCAGCAGC0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGATGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.160920
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.155340
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.152381
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCCTCAAGGAAGATAATGACGGTACTTGAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.125196
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__PseudomonadaceaeTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGGGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.112281
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGAGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.112000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__Methylophilaceae;g__MethylophilusTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAATATGTCAGAGGGGGGTAGAATTCCACG0.109091
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__HydrogenophagaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGTCGTGAAATCCCCGGGCTCAACCTGGGAATTGCGATTGTGACTGCAAAGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.108626
d__BacteriaCACGTAGGATCCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGTGGTTTGTTAAGTTGGATGTTAAATCTCTTGGCTCAACTGAGAGGTGTCGTTCAAAACTAGCAGACTGGAGGACGGTAGAGGAAGGTAGAATTCCGGG0.107914

Annotations:

common ontology terms
term enrichment score
TermScore
germany0.797203
rhizosphere0.167274
haplic luvisol0.140234
triticum aestivum0.132701
formula fed0.131868
thyrow0.124183
lettuce0.124183
breast fed0.114943
pot expreiment0.110465
wolf0.110193
crop rotation0.106667
bernburg0.106667
salamandra salamandra0.103270
age 35 weeks0.101266
hen0.096386
fire salamander0.088435
canis lupus0.087912
ph 7.60.087912
amphibian larval stage0.084691
bonn0.082192
campus klein-altendorf0.082192
albic luvisol0.082192
calve0.078947
holstein dairy cow0.075949
juvenile stage0.075949
bulk soil0.071778
age 7 months0.069444
janvier labs0.069444
3-month-old human stage0.068182
silty clay loam0.067114
ph 6.90.067114
soil0.065338
skin0.064865
mineral fertilization0.062937
npk fertilization0.061017
feces0.058065
larval stage0.057778
chicken0.057554
captive0.057366
LOWER IN other plants0.056338
other plants0.056338
minqin county0.056338
nasal wash0.056338
gallus gallus0.055944
ph 90.054795
12-month-old human stage0.054381
infant0.054242
depth (soil) 50cm0.053333
c57bl/6j0.052910
research facility0.052655
homo sapiens0.050718
1-month-old human stage0.050633
mouth mucosa0.050279
nasopharynx0.050279
organic fertilization0.049645
maize pre-crop0.049645
bos taurus0.049587
sand0.049383
digesta0.049383
age 140 days0.048443
manure fertilization0.048443
age 18 weeks0.048443
desert0.048193
austria0.047059
dog0.045992
canis lupus familiaris0.045366
manured soil0.045161
adult0.045045
oral cavity0.044665
keil urban district0.043796
bülker leuchtturm0.043796
subgingival plaque0.043682
city of dresden0.042857
lower saxony0.042857
sandy soil0.042857
ph 6.40.042857
mouldboard plough0.042857
rapeseed pre-crop0.042857
cultivator tillage0.042857
high sugar diet0.042857
switzerland0.042296
depth (soil) 20-60cm0.042105
adult organism0.042105
brassica napus0.041958
conservation tillage0.041958
type 2 diabetes mellitus0.041096
maize field0.041096
conventional tillage0.041096
parkinson's disease0.040268
ph 50.040268
dentition0.040172
ileum0.038835
female0.038356
mouse0.037855
pond0.037267
LOWER IN wolf0.036134
mucosa0.036036
rem sleep behavior disorder0.035971
intestine0.035857
mus musculus0.035821
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN baltic sea coastal waters of germany and poland1.000000
fucus vesiculosus1.000000
keil urban district1.000000
bülker leuchtturm1.000000
baltic sea coastal waters of germany and poland1.000000
LOWER IN fucus vesiculosus1.000000
germany0.750000
wolf0.714286
LOWER IN end0.666667
end0.666667
salamandra salamandra0.666667
haplic luvisol0.666667
LOWER IN wolf0.571429
seaweed0.500000
fucus0.500000
rockweed0.500000
red fescue grass0.500000
festuca rubra0.500000
LOWER IN other plants0.500000
other plants0.500000
LOWER IN festuca rubra0.500000
LOWER IN red fescue grass0.500000
galium mollugo0.500000
hedge bedstraw0.500000
LOWER IN hedge bedstraw0.500000
LOWER IN galium mollugo0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN meadow geranium0.500000
LOWER IN geranium pratense0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
LOWER IN common sainfoin0.500000
LOWER IN onobrychis viciifolia0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
LOWER IN ribwort plantain0.500000
LOWER IN plantago lanceolata0.500000
bermuda0.500000
beginning0.500000
LOWER IN beginning0.500000
prunella vulgaris0.500000
woundwort0.500000
LOWER IN woundwort0.500000
LOWER IN prunella vulgaris0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
LOWER IN germander speedwell0.500000
LOWER IN veronica chamaedrys0.500000
fire salamander0.500000
minqin county0.500000
nitraria tangutorum0.500000
haloxylon ammodendron0.500000
LOWER IN haloxylon ammodendron0.500000
LOWER IN nitraria tangutorum0.500000
age 7 months0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
LOWER IN age 7 months0.500000
coffea arabica0.500000
start0.500000
LOWER IN start0.500000
ileal mucosa0.500000
LOWER IN ileal mucosa0.500000
age 50-70 years0.500000
bonn0.500000
campus klein-altendorf0.500000
depth (soil) 45-75cm0.500000
depth (soil) 75-105cm0.500000
LOWER IN depth (soil) 75-105cm0.500000
LOWER IN depth (soil) 45-75cm0.500000
city of dresden0.500000
fvb/n mice0.500000
nasal wash0.500000
rem sleep behavior disorder0.500000
LOWER IN rem sleep behavior disorder0.500000
bufo bufo0.500000
common toad0.500000
dog breeding center0.500000
LOWER IN dog breeding center0.500000
wildlife sactuary0.500000
LOWER IN wildlife sactuary0.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
LOWER IN organic fertilization0.500000
LOWER IN mineral fertilization0.500000
bio-dynamic fertilizer0.500000
LOWER IN bio-dynamic fertilizer0.500000
endurance athlete0.500000
crop rotation0.500000
Fraction of annotations for the query sequences containing the term
TermScore
germany0.850746
feces0.324627
homo sapiens0.302239
rhizosphere0.242537
soil0.186567
research facility0.179104
infant0.145522
triticum aestivum0.104478
formula fed0.089552
haplic luvisol0.078358
breast fed0.074627
adult0.074627
thyrow0.070896
lettuce0.070896
pot expreiment0.070896
wolf0.059701
canis lupus0.059701
china0.059701
age 35 weeks0.059701
hen0.059701
chicken0.059701
gallus gallus0.059701
crop rotation0.059701
ph 7.60.059701
bernburg0.059701
salamandra salamandra0.055970
female0.052239
fire salamander0.048507
larval stage0.048507
amphibian larval stage0.048507
skin0.044776
3-month-old human stage0.044776
holstein dairy cow0.044776
calve0.044776
bos taurus0.044776
juvenile stage0.044776
bonn0.044776
campus klein-altendorf0.044776
mouse0.044776
mus musculus0.044776
albic luvisol0.044776
captive0.041045
bulk soil0.041045
age 7 months0.037313
silty clay loam0.037313
ph 6.90.037313
c57bl/6j0.037313
janvier labs0.037313
intestine0.033582
12-month-old human stage0.033582
mouth mucosa0.033582
oral cavity0.033582
nasopharynx0.033582
mineral fertilization0.033582
npk fertilization0.033582
LOWER IN other plants0.029851
other plants0.029851
depth (soil) 20-60cm0.029851
sand0.029851
ph 90.029851
minqin county0.029851
depth (soil) 50cm0.029851
desert0.029851
1-month-old human stage0.029851
mucosa0.029851
ileum0.029851
digesta0.029851
caecum0.029851
nasal wash0.029851
adult organism0.029851
austria0.029851
age 140 days0.026119
dentition0.026119
subgingival plaque0.026119
control0.026119
canis lupus familiaris0.026119
dog0.026119
manured soil0.026119
manure fertilization0.026119
organic fertilization0.026119
switzerland0.026119
maize pre-crop0.026119
age 18 weeks0.026119
keil urban district0.022388
bülker leuchtturm0.022388
pond0.022388
city of dresden0.022388
type 2 diabetes mellitus0.022388
parkinson's disease0.022388
ph 50.022388
lower saxony0.022388
sandy soil0.022388
maize field0.022388
ph 6.40.022388
mouldboard plough0.022388
conventional tillage0.022388
brassica napus0.022388
rapeseed pre-crop0.022388
cultivator tillage0.022388
conservation tillage0.022388
Number of experiments associating the term to the sequence
TermScore
germany24.000000
feces11.000000
homo sapiens8.000000
rhizosphere6.000000
adult6.000000
wolf5.000000
canis lupus5.000000
research facility5.000000
canis lupus familiaris5.000000
dog5.000000
skin4.000000
soil4.000000
LOWER IN wolf4.000000
china3.000000
LOWER IN end2.000000
end2.000000
salamandra salamandra2.000000
female2.000000
triticum aestivum2.000000
haplic luvisol2.000000
dentition2.000000
subgingival plaque2.000000
mouse2.000000
mus musculus2.000000
control2.000000
captive2.000000
bulk soil2.000000
LOWER IN baltic sea coastal waters of germany and poland1.000000
seaweed1.000000
fucus1.000000
fucus vesiculosus1.000000
rockweed1.000000
keil urban district1.000000
bülker leuchtturm1.000000
red fescue grass1.000000
festuca rubra1.000000
LOWER IN other plants1.000000
other plants1.000000
LOWER IN festuca rubra1.000000
LOWER IN red fescue grass1.000000
galium mollugo1.000000
hedge bedstraw1.000000
LOWER IN hedge bedstraw1.000000
LOWER IN galium mollugo1.000000
geranium pratense1.000000
meadow geranium1.000000
LOWER IN meadow geranium1.000000
LOWER IN geranium pratense1.000000
lathyrus pratensis1.000000
meadow pea-vine1.000000
LOWER IN meadow pea-vine1.000000
LOWER IN lathyrus pratensis1.000000
onobrychis viciifolia1.000000
common sainfoin1.000000
LOWER IN common sainfoin1.000000
LOWER IN onobrychis viciifolia1.000000
plantago lanceolata1.000000
ribwort plantain1.000000
LOWER IN ribwort plantain1.000000
LOWER IN plantago lanceolata1.000000
bermuda1.000000
beginning1.000000
LOWER IN beginning1.000000
prunella vulgaris1.000000
woundwort1.000000
LOWER IN woundwort1.000000
LOWER IN prunella vulgaris1.000000
veronica chamaedrys1.000000
germander speedwell1.000000
LOWER IN germander speedwell1.000000
LOWER IN veronica chamaedrys1.000000
fire salamander1.000000
larval stage1.000000
amphibian larval stage1.000000
intestine1.000000
pond1.000000
depth (soil) 20-60cm1.000000
sand1.000000
ph 91.000000
minqin county1.000000
depth (soil) 50cm1.000000
desert1.000000
nitraria tangutorum1.000000
haloxylon ammodendron1.000000
LOWER IN haloxylon ammodendron1.000000
LOWER IN nitraria tangutorum1.000000
1-month-old human stage1.000000
breast fed1.000000
infant1.000000
formula fed1.000000
3-month-old human stage1.000000
age 7 months1.000000
12-month-old human stage1.000000
LOWER IN bifidobacterium supplement1.000000
bifidobacterium supplement1.000000
LOWER IN age 7 months1.000000
age 140 days1.000000
holstein dairy cow1.000000
calve1.000000
bos taurus1.000000
juvenile stage1.000000
mouth mucosa1.000000
oral cavity1.000000
coffea arabica1.000000
start1.000000
LOWER IN start1.000000
ileal mucosa1.000000
mucosa1.000000
ileum1.000000
age 35 weeks1.000000
hen1.000000
chicken1.000000
gallus gallus1.000000
digesta1.000000
LOWER IN ileal mucosa1.000000
caecum1.000000
age 50-70 years1.000000
bonn1.000000
campus klein-altendorf1.000000
silty clay loam1.000000
ph 6.91.000000
depth (soil) 45-75cm1.000000
depth (soil) 75-105cm1.000000
LOWER IN depth (soil) 75-105cm1.000000
LOWER IN depth (soil) 45-75cm1.000000
city of dresden1.000000
type 2 diabetes mellitus1.000000
fvb/n mice1.000000
nasopharynx1.000000
nasal wash1.000000
parkinson's disease1.000000
rem sleep behavior disorder1.000000
LOWER IN rem sleep behavior disorder1.000000
bufo bufo1.000000
common toad1.000000
dog breeding center1.000000
LOWER IN dog breeding center1.000000
wildlife sactuary1.000000
LOWER IN wildlife sactuary1.000000
ph 51.000000
lower saxony1.000000
sandy soil1.000000
maize field1.000000
mineral fertilization1.000000
npk fertilization1.000000
thyrow1.000000
albic luvisol1.000000
ph 6.41.000000
lettuce1.000000
pot expreiment1.000000
manured soil1.000000
manure fertilization1.000000
organic fertilization1.000000
LOWER IN organic fertilization1.000000
LOWER IN mineral fertilization1.000000
switzerland1.000000
bio-dynamic fertilizer1.000000
LOWER IN bio-dynamic fertilizer1.000000
endurance athlete1.000000
crop rotation1.000000
ph 7.61.000000
mouldboard plough1.000000
conventional tillage1.000000
bernburg1.000000
maize pre-crop1.000000
brassica napus1.000000
rapeseed pre-crop1.000000
cultivator tillage1.000000
conservation tillage1.000000
c57bl/6j1.000000
janvier labs1.000000
high sugar diet1.000000
age 18 weeks1.000000
adult organism1.000000
austria1.000000
baltic sea coastal waters of germany and poland1.000000
LOWER IN fucus vesiculosus1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
607amnon high in control compared to parkinson's disease in germany nasopharynx homo sapiens nasal wash 2020-04-19v41 / 1approvedNo
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v41 / 3approvedNo
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 3approvedNo
67amnonincreases during fermentation of coffee beans ( high in end compared to start in coffea arabica ecuador )2017-02-19v41 / 3approvedNo
607amnon high in parkinson's disease rem sleep behavior disorder compared to control in germany homo sapiens feces 2020-04-19v41 / 3approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 4approvedNo
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in germany homo sapiens feces 2020-04-19v41 / 4approvedNo
309amnondominant rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v41 / 5approvedNo
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 5approvedNo
607amnon high in parkinson's disease compared to control in germany nasopharynx homo sapiens nasal wash 2020-04-19v41 / 5approvedNo
792amnondominant depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v41 / 6approvedNo
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, rumen, juvenile stage, research facility2022-05-20v11 / 6approvedNo
67amnondisappears during fermentation of coffee beans ( high in start compared to end in coffea arabica ecuador )2017-02-19v41 / 6approvedNo
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v31 / 6approvedNo
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v41 / 7approvedNo
792amnondominant depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v41 / 7approvedNo
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v31 / 7approvedNo
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in chest skin adult organism captive austria research facility 2022-03-12v41 / 7approvedNo
309amnondominant rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v41 / 8approvedNo
792amnondominant depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v41 / 8approvedNo
761sheryoDominant in bulk sandy soil maize field in Germany (dominant ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v31 / 8approvedNo
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v31 / 8approvedNo
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant rapeseed pre-crop, brassica napus, maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v31 / 8approvedNo
879amnon high in wolf canis lupus compared to dog canis lupus familiaris in adult organism chest captive austria skin research facility 2022-03-12v41 / 8approvedNo
309amnondominant rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v41 / 9approvedNo
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 9approvedNo
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 9approvedNo
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v11 / 9approvedNo
607amnonhigher in blanks compared to nasopharyngeal samples (contamination)2020-04-19v41 / 9approvedNo
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v31 / 9approvedNo
309amnondominant rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v41 / 10approvedNo
309amnondominant rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v41 / 10approvedNo
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 10approvedNo
910amnondominant age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v11 / 10approvedNo
808amnondominant caecum, digesta, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 10approvedNo
820naDominant in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 10approvedNo
638amnondominant fermented beverage, stuttgart, germany, wine food product2020-08-21v41 / 10approvedNo
309amnondominant lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v41 / 11approvedNo
309amnondominant rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v41 / 11approvedNo
808amnondominant caecum, mucosa, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 11approvedNo
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 11approvedNo
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 12approvedNo
797amnoncommon breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 12approvedNo
879amnondominant wolf, canis lupus, adult organism, chest, captive, austria, skin, research facility2022-03-12v41 / 12approvedNo
309amnondominant rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v41 / 13approvedNo
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v41 / 13approvedNo
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 13approvedNo
808amnondominant ileal mucosa, mucosa, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 13approvedNo
492amnondominant skin, adult, germany, bufo bufo, toad, common toad2019-02-27v41 / 13approvedNo
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v31 / 13approvedNo
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 13approvedNo
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 14approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 14approvedNo
797amnondominant breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 14approvedNo
820nadominant in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (dominant silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 14approvedNo
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v41 / 14approvedNo
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in china feces 2022-02-08v31 / 14approvedNo
1015amnondominant germany, keil urban district, bülker leuchtturm, sea water, baltic sea coastal waters of germany and poland2023-03-31v31 / 14approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
808amnondominant digesta, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 15approvedNo
910amnondominant holstein dairy cow, age 42 days, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v11 / 15approvedNo
291amnondominant canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v41 / 15approvedNo
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v31 / 15approvedNo
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (dominant manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v31 / 15approvedNo
126amnondominant rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v41 / 15approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v41 / 16approvedNo
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v41 / 16approvedNo
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v41 / 16approvedNo
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v31 / 16approvedNo
797amnon high in breast fed compared to formula fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 17approvedNo
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 17approvedNo
607amnondominant germany, homo sapiens, feces, control2020-04-19v41 / 17approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v41 / 17approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v41 / 17approvedNo
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v31 / 17approvedNo
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v41 / 18approvedNo
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 18approvedNo
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v41 / 18approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v41 / 18approvedNo
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v41 / 19approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 19approvedNo
1015amnondominant algae, germany, keil urban district, bülker leuchtturm, fucus vesiculosus, seaweed, rockweed, fucus2023-03-31v31 / 19approvedNo
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 20approvedNo
759amnondominant wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v41 / 20approvedNo
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v41 / 20approvedNo
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v41 / 21approvedNo
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v41 / 21approvedNo
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 21approvedNo
377amnondominant salamandra salamandra, salamander, skin, germany2018-09-12v41 / 21approvedNo
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v41 / 21approvedNo
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v41 / 21approvedNo
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (dominant pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v31 / 21approvedNo
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (dominant organic fertilization, manure fertilization, manured soil, pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v31 / 21approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 21approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 22approvedNo
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 22approvedNo
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 22approvedNo
865amnondominant wolf, china, canis lupus, feces2022-02-08v31 / 22approvedNo
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v31 / 23approvedNo
303amnondominant homo sapiens, feces, germany, adult2018-03-12v41 / 23approvedNo
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 25approvedNo
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v31 / 25approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v41 / 25approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 27approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 28approvedNo
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 28approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 29approvedNo
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v31 / 30approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v41 / 31approvedNo
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 31approvedNo
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to rapeseed pre-crop brassica napus in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v31 / 31approvedNo
666amnoncommon wild, wolf, canis lupus, italy, feces2020-09-25v31 / 32approvedNo
865amnon high in dog canis lupus familiaris compared to canis lupus wolf in china feces 2022-02-08v31 / 35approvedNo
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v41 / 37approvedNo
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v31 / 38approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 39approvedNo
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v31 / 40approvedNo
762sheryoHigh in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in mineral fertilization npk fertilization compared to organic fertilization manure fertilization manured soil bio-dynamic fertilizer in thyrow switzerland haplic luvisol pot expreiment lettuce soil rhizosphere )2021-04-08v31 / 40approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v31 / 44approvedNo
149amnonhigher in larvae ever in a pond (original or transferred) compared to only stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v41 / 45approvedNo
879amnon high in dog canis lupus familiaris compared to wolf canis lupus in captive adult organism austria research facility feces 2022-03-12v41 / 45approvedNo
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 46approvedNo
638amnoncommon fermented beverage, stuttgart, germany, wine food product2020-08-21v41 / 46approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v41 / 49approvedNo
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 50approvedNo
865amnoncommon canis lupus, wolf, china, feces2022-02-08v31 / 51approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v31 / 52approvedNo
764sheryoHigh in convetional tillage compared to conservation tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in mouldboard plough conventional tillage compared to cultivator tillage conservation tillage in rapeseed pre-crop brassica napus ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v31 / 52approvedNo
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v41 / 55approvedNo
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in cultivator tillage conservation tillage compared to mouldboard plough conventional tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v31 / 56approvedNo
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v41 / 57approvedNo
808amnoncommon ileal mucosa, mucosa, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 58approvedNo
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v41 / 58approvedNo
759amnoncommon wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v41 / 58approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v41 / 60approvedNo
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 60approvedNo
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v41 / 67approvedNo
764sheryoHigh in conservation tillage compared to conventional tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in bernburg germany soil triticum aestivum crop rotation ph 7.6 brassica napus rapeseed pre-crop )2021-04-12v31 / 68approvedNo
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 69approvedNo
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v41 / 71approvedNo
808amnoncommon digesta, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 72approvedNo
764sheryoHigh in conventional tillage compared to conservation tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v31 / 72approvedNo
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v41 / 73approvedNo
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v31 / 74approvedNo
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 75approvedNo
759amnon high in wildlife sactuary canis lupus wolf compared to dog canis lupus familiaris in state of minnesota united states of america feces 2021-04-06v41 / 78approvedNo
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v31 / 81approvedNo
820naHigher in 45-5cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 83approvedNo
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 89approvedNo
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v31 / 91approvedNo
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v41 / 93approvedNo
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v41 / 98approvedNo
149amnon high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v41 / 103approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 106approvedNo
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v41 / 106approvedNo
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v41 / 107approvedNo
309amnon high in other plants compared to hedge bedstraw galium mollugo in rhizosphere germany 2018-04-05v41 / 110approvedNo
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 115approvedNo
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v41 / 115approvedNo
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v41 / 117approvedNo
792amnon high in rhizosphere nitraria tangutorum haloxylon ammodendron compared to soil in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v41 / 118approvedNo
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v41 / 125approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 126approvedNo
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v41 / 127approvedNo
607amnoncommon germany, homo sapiens, feces, control2020-04-19v41 / 128approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 130approvedNo
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v41 / 132approvedNo
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v41 / 134approvedNo
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v31 / 139approvedNo
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v31 / 139approvedNo
1015amnon high in seaweed algae fucus fucus vesiculosus rockweed compared to sea water baltic sea coastal waters of germany and poland in germany keil urban district bülker leuchtturm 2023-03-31v31 / 141approvedNo
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v41 / 144approvedNo
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in state of minnesota united states of america feces 2021-04-06v41 / 148approvedNo
9amnonhigher at end of experiment (grows at later times) ( high in end compared to beginning in bermuda sea water )2016-10-27v41 / 158approvedNo
820naHigher in 75-105cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 159approvedNo
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v41 / 167approvedNo
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to brassica napus rapeseed pre-crop in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v31 / 173approvedNo
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manure fertilization manured soil organic fertilization compared to mineral fertilization npk fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v31 / 176approvedNo
910amnoncommon age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v11 / 191approvedNo
808amnon high in digesta compared to ileal mucosa mucosa in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 192approvedNo
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v31 / 200approvedNo
910amnoncommon age 42 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v11 / 202approvedNo
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 203approvedNo
808amnon high in ileum compared to caecum in digesta germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 224approvedNo
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v31 / 226approvedNo
1015amnon high in sea water baltic sea coastal waters of germany and poland compared to rockweed fucus fucus vesiculosus seaweed algae in bülker leuchtturm keil urban district germany 2023-03-31v31 / 231approvedNo
910amnoncommon mouth mucosa, oral cavity, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v11 / 245approvedNo
808amnon high in digesta compared to mucosa in caecum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 266approvedNo
309amnon high in other plants compared to meadow geranium geranium pratense in rhizosphere germany 2018-04-05v41 / 267approvedNo
910amnon high in age 70 days compared to age 140 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v11 / 276approvedNo
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v31 / 286approvedNo
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v31 / 294approvedNo
910amnon high in age 140 days compared to age 70 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v11 / 302approvedNo
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v41 / 316approvedNo
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v41 / 320approvedNo
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v31 / 325approvedNo
309amnon high in other plants compared to ribwort plantain plantago lanceolata in rhizosphere germany 2018-04-05v41 / 352approvedNo
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v41 / 352approvedNo
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v31 / 353approvedNo
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v41 / 355approvedNo
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v31 / 359approvedNo
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v41 / 383approvedNo
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v41 / 404approvedNo
808amnoncommon caecum, digesta, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 406approvedNo
1015amnoncommon baltic sea coastal waters of germany and poland, sea water, bülker leuchtturm, keil urban district, germany2023-03-31v31 / 418approvedNo
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v41 / 420approvedNo
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v41 / 432approvedNo
1015amnoncommon fucus, rockweed, seaweed, fucus vesiculosus, bülker leuchtturm, keil urban district, germany, algae2023-03-31v31 / 433approvedNo
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v41 / 443approvedNo
808amnoncommon caecum, mucosa, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v11 / 446approvedNo
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v31 / 455approvedNo
910amnoncommon rumen, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v11 / 510approvedNo
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v31 / 531approvedNo
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v41 / 550approvedNo
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v31 / 577approvedNo
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v31 / 578approvedNo
808amnon high in ileum compared to caecum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 587approvedNo
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v41 / 595approvedNo
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v41 / 617approvedNo
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v41 / 618approvedNo
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 648approvedNo
309amnon high in lathyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v41 / 680approvedNo
820naHigher in 45-75cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 686approvedNo
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v41 / 688approvedNo
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 700approvedNo
808amnon high in mucosa compared to digesta in caecum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 701approvedNo
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v31 / 704approvedNo
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 740approvedNo
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v31 / 742approvedNo
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v41 / 781approvedNo
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v41 / 800approvedNo
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v31 / 835approvedNo
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 917approvedNo
820naHigher in 0-20cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 923approvedNo
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v41 / 925approvedNo
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 1011approvedNo
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v31 / 1129approvedNo
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v31 / 1140approvedNo
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v11 / 1194approvedNo
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v31 / 1213approvedNo
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v41 / 1217approvedNo
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v31 / 1225approvedNo
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v41 / 1272approvedNo
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v41 / 1296approvedNo
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v41 / 1323approvedNo
808amnon high in ileal mucosa mucosa compared to digesta in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 1360approvedNo
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v41 / 1386approvedNo
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v41 / 1434approvedNo
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v41 / 1510approvedNo
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v41 / 1599approvedNo
910amnon high in rumen compared to mouth mucosa oral cavity in age 140 days holstein dairy cow calve germany bos taurus juvenile stage research facility 2022-05-20v11 / 1744approvedNo
808amnon high in caecum compared to ileum in digesta germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 1776approvedNo
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v41 / 1788approvedNo
808amnon high in caecum compared to ileum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 2147approvedNo

Problems / suggestions? Please email info AT dbbact DOT org