Summary for ontology term: germany

Number of annotations with term: 262

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.015444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.015444
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCGTAGGCGGGGGGTCAAATCCCGGGGCTCAACCCCGGTCCGCCCCCCGAACCCCGCGGCTCGGGTCCGGTAGGGGAGGGTGGAATTCCCGGT0.015444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.015444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGATTCTTAAGTGAGATGTGAAATACCCGGGCTTAACTTGGGTGCTGCATTTCAAACTGGGAATCTAGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.011583
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTCTGTTAAGTCGGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.011583
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.011583
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegamonasTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAATTAAGCGGATCTTAAAAGTGCGGGGCTCAACCTCGTGAGGGGGTCCGAACTGATTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.011583
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.011583
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGATGCGTAGGCGGATATTTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.011583

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.600000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.600000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGTCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.600000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTAAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCAGGGGCTCAACCCCTGGACTGCATTGGAAACTGTCAGTCTTGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGAGAAACTTGAGTGCAGGAGAGGAGAGTAGAATTCCTAGT0.600000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCCTTTTAAGTCGGAAGTGAAATTTCGGGGCTCAACCCCGGAGCTGCTACCGAAACTGAGAGGCTAGAGTGTGGGAGAGGAAAGTGGAACTTTGAG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCACAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCTGGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTTGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCGCCGGCTAACTACGTGCCAGCAGC0.169935
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGATGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.163743
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.157377
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.155844
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCCTCAAGGAAGATAATGACGGTACTTGAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.132231
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGAGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.113821
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__PseudomonadaceaeTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGGGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.113475
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__HydrogenophagaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGTCGTGAAATCCCCGGGCTCAACCTGGGAATTGCGATTGTGACTGCAAAGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.110032
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__Methylophilaceae;g__MethylophilusTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAATATGTCAGAGGGGGGTAGAATTCCACG0.109948
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.109375

Annotations:

common ontology terms
term enrichment score
TermScore
germany0.819320
rhizosphere0.175993
haplic luvisol0.143101
triticum aestivum0.134615
formula fed0.134078
thyrow0.126667
lettuce0.126667
breast fed0.116959
wolf0.116448
pot expreiment0.112426
bernburg0.108844
crop rotation0.108844
salamandra salamandra0.105448
age 35 weeks0.103226
hen0.103226
canis lupus0.092700
fire salamander0.090278
ph 7.60.089385
amphibian larval stage0.086379
calve0.083916
bonn0.083916
campus klein-altendorf0.083916
albic luvisol0.083916
juvenile stage0.080537
holstein dairy cow0.080537
bulk soil0.073211
age 7 months0.070922
silty clay loam0.070922
janvier labs0.070922
3-month-old human stage0.069364
ph 6.90.068493
soil0.066689
skin0.066482
mineral fertilization0.064286
feces0.063377
npk fertilization0.062284
chicken0.061776
infant0.061129
captive0.060942
gallus gallus0.059925
larval stage0.058559
LOWER IN other plants0.057554
other plants0.057554
minqin county0.057554
sand0.057554
nasal wash0.057554
research facility0.057375
ph 90.055944
12-month-old human stage0.055385
c57bl/6j0.055249
depth (soil) 50cm0.054422
homo sapiens0.053894
mouth mucosa0.052478
1-month-old human stage0.051613
bos taurus0.051502
nasopharynx0.051136
age 140 days0.050725
organic fertilization0.050725
maize pre-crop0.050725
age 18 weeks0.050725
digesta0.050314
austria0.050314
manure fertilization0.049470
desert0.049080
adult organism0.049080
adult0.047695
dog0.047587
canis lupus familiaris0.046917
oral cavity0.046392
manured soil0.046053
subgingival plaque0.045016
city of dresden0.043796
lower saxony0.043796
sandy soil0.043796
ph 6.40.043796
mouldboard plough0.043796
rapeseed pre-crop0.043796
cultivator tillage0.043796
high sugar diet0.043796
switzerland0.043077
brassica napus0.042857
conservation tillage0.042857
depth (soil) 20-60cm0.042781
type 2 diabetes mellitus0.041958
parkinson's disease0.041958
maize field0.041958
conventional tillage0.041958
ph 50.041096
ileum0.041026
dentition0.040876
female0.039829
mouse0.039735
pond0.038710
mucosa0.037915
mus musculus0.037500
rem sleep behavior disorder0.037453
LOWER IN wolf0.037453
intestine0.036961
LOWER IN dog0.034394
2-year-old human stage0.034247
Fraction of dbbact annotations with this term covered by the query
TermScore
wolf1.250000
bermuda1.000000
rem sleep behavior disorder1.000000
LOWER IN rem sleep behavior disorder1.000000
LOWER IN wolf1.000000
germany0.793103
LOWER IN end0.666667
end0.666667
salamandra salamandra0.666667
haplic luvisol0.666667
red fescue grass0.500000
festuca rubra0.500000
LOWER IN other plants0.500000
other plants0.500000
LOWER IN red fescue grass0.500000
LOWER IN festuca rubra0.500000
galium mollugo0.500000
hedge bedstraw0.500000
LOWER IN galium mollugo0.500000
LOWER IN hedge bedstraw0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN geranium pratense0.500000
LOWER IN meadow geranium0.500000
meadow pea-vine0.500000
lathyrus pratensis0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
LOWER IN onobrychis viciifolia0.500000
LOWER IN common sainfoin0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
LOWER IN plantago lanceolata0.500000
LOWER IN ribwort plantain0.500000
beginning0.500000
LOWER IN beginning0.500000
prunella vulgaris0.500000
woundwort0.500000
LOWER IN prunella vulgaris0.500000
LOWER IN woundwort0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
LOWER IN veronica chamaedrys0.500000
LOWER IN germander speedwell0.500000
fire salamander0.500000
minqin county0.500000
sand0.500000
nitraria tangutorum0.500000
haloxylon ammodendron0.500000
LOWER IN haloxylon ammodendron0.500000
LOWER IN nitraria tangutorum0.500000
age 7 months0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
LOWER IN age 7 months0.500000
calve0.500000
age 140 days0.500000
age 42 days0.500000
LOWER IN age 140 days0.500000
start0.500000
coffea arabica0.500000
LOWER IN start0.500000
ileal mucosa0.500000
LOWER IN ileal mucosa0.500000
age 50-70 years0.500000
bonn0.500000
campus klein-altendorf0.500000
depth (soil) 45-75cm0.500000
silty clay loam0.500000
depth (soil) 75-105cm0.500000
LOWER IN depth (soil) 45-75cm0.500000
LOWER IN depth (soil) 75-105cm0.500000
city of dresden0.500000
fvb/n mice0.500000
nasal wash0.500000
bufo bufo0.500000
common toad0.500000
dog breeding center0.500000
LOWER IN dog breeding center0.500000
wildlife sactuary0.500000
LOWER IN wildlife sactuary0.500000
lower saxony0.500000
sandy soil0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
mineral fertilization0.500000
organic fertilization0.500000
LOWER IN organic fertilization0.500000
LOWER IN mineral fertilization0.500000
bio-dynamic fertilizer0.500000
LOWER IN bio-dynamic fertilizer0.500000
endurance athlete0.500000
bernburg0.500000
loess chernozem0.500000
mouldboard plough0.500000
crop rotation0.500000
Fraction of annotations for the query sequences containing the term
TermScore
germany0.847328
feces0.332061
homo sapiens0.309160
rhizosphere0.248092
soil0.190840
research facility0.183206
infant0.148855
triticum aestivum0.106870
formula fed0.091603
haplic luvisol0.080153
breast fed0.076336
adult0.076336
thyrow0.072519
pot expreiment0.072519
lettuce0.072519
canis lupus0.061069
wolf0.061069
china0.061069
gallus gallus0.061069
chicken0.061069
age 35 weeks0.061069
hen0.061069
ph 7.60.061069
bernburg0.061069
crop rotation0.061069
salamandra salamandra0.057252
female0.053435
larval stage0.049618
amphibian larval stage0.049618
fire salamander0.049618
skin0.045802
3-month-old human stage0.045802
juvenile stage0.045802
bos taurus0.045802
calve0.045802
holstein dairy cow0.045802
bonn0.045802
campus klein-altendorf0.045802
mus musculus0.045802
mouse0.045802
albic luvisol0.045802
captive0.041985
bulk soil0.041985
age 7 months0.038168
ph 6.90.038168
silty clay loam0.038168
c57bl/6j0.038168
janvier labs0.038168
intestine0.034351
12-month-old human stage0.034351
oral cavity0.034351
mouth mucosa0.034351
nasopharynx0.034351
npk fertilization0.034351
mineral fertilization0.034351
LOWER IN other plants0.030534
other plants0.030534
desert0.030534
depth (soil) 50cm0.030534
minqin county0.030534
sand0.030534
ph 90.030534
depth (soil) 20-60cm0.030534
1-month-old human stage0.030534
mucosa0.030534
ileum0.030534
digesta0.030534
caecum0.030534
nasal wash0.030534
austria0.030534
adult organism0.030534
age 140 days0.026718
dentition0.026718
subgingival plaque0.026718
control0.026718
canis lupus familiaris0.026718
dog0.026718
manured soil0.026718
manure fertilization0.026718
organic fertilization0.026718
switzerland0.026718
maize pre-crop0.026718
age 18 weeks0.026718
pond0.022901
type 2 diabetes mellitus0.022901
city of dresden0.022901
parkinson's disease0.022901
ph 50.022901
maize field0.022901
lower saxony0.022901
sandy soil0.022901
ph 6.40.022901
conventional tillage0.022901
mouldboard plough0.022901
brassica napus0.022901
rapeseed pre-crop0.022901
conservation tillage0.022901
cultivator tillage0.022901
high sugar diet0.022901
stream0.019084
Exp. ID User ID Description Date Region Flag Sequences
607amnon high in control compared to parkinson's disease in homo sapiens nasopharynx germany nasal wash 2020-04-19v4No1 / 1
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander )2017-04-24v4No1 / 3
797amnon high in bifidobacterium supplement compared to control diet in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 3
67amnonincreases during fermentation of coffee beans ( high in end compared to start in coffea arabica ecuador )2017-02-19v4No1 / 3
607amnon high in rem sleep behavior disorder parkinson's disease compared to control in feces homo sapiens germany 2020-04-19v4No1 / 3
797amnon high in age 7 months compared to 12-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 4
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in feces homo sapiens germany 2020-04-19v4No1 / 4
309amnondominant rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 5
797amnon high in control diet compared to bifidobacterium supplement in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 5
607amnon high in parkinson's disease compared to control in homo sapiens nasopharynx germany nasal wash 2020-04-19v4No1 / 5
792amnondominant desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 6
910amnondominant research facility, juvenile stage, rumen, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 6
67amnondisappears during fermentation of coffee beans ( high in start compared to end in coffea arabica ecuador )2017-02-19v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 6
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander )2017-04-24v4No1 / 7
792amnondominant desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 7
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 7
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 7
309amnondominant rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 8
792amnondominant desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 8
761sheryoDominant in bulk sandy soil maize field in Germany (dominant bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, maize pre-crop, rapeseed pre-crop)2021-04-12v3No1 / 8
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 8
309amnondominant rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 9
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 9
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (dominant soil, rhizosphere, triticum aestivum, germany, ph 6.5, silt loam, bonn, haplic luvisol, campus klein-altendorf, depth (soil) 0-20cm)2021-07-14v1No1 / 9
607amnonhigher in blanks compared to nasopharyngeal samples (contamination)2020-04-19v4No1 / 9
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 9
309amnondominant rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 10
309amnondominant rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 10
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 10
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 70 days2022-05-20v1No1 / 10
808amnondominant research facility, caecum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 10
820naDominant in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (dominant soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, silty clay loam, depth (soil) 75-105cm)2021-07-14v1No1 / 10
638amnondominant germany, fermented beverage, wine food product, stuttgart2020-08-21v4No1 / 10
309amnondominant rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 11
309amnondominant rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 11
808amnondominant research facility, mucosa, caecum, gallus gallus, germany, chicken, age 35 weeks, hen2021-06-20v1No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 11
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
879amnondominant research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 12
309amnondominant rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 13
149amnondominant stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 13
808amnondominant research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 13
492amnondominant skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 13
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 14
797amnondominant feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 14
820nadominant in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (dominant soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, depth (soil) 45-75cm, silty clay loam)2021-07-14v1No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in feces china 2022-02-08v3No1 / 14
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, age 42 days, holstein dairy cow2022-05-20v1No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
808amnondominant research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 15
291amnondominant nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (dominant soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 15
126amnondominant rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 15
607amnondominant homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 16
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 16
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 17
149amnondominant mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
607amnondominant feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 18
607amnondominant homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 18
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
797amnondominant feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 19
607amnoncommon homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
759amnondominant feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 20
879amnondominant feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 20
149amnondominant pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
703amnondominant homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 21
377amnondominant skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (dominant soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (dominant soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, npk fertilization, albic luvisol, lettuce, mineral fertilization, organic fertilization)2021-04-08v3No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
248amnondominant feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 22
865amnondominant feces, canis lupus, china, wolf2022-02-08v3No1 / 22
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
607amnoncommon homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 25
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to zea mays maize pre-crop in soil triticum aestivum germany ph 7.6 bernburg crop rotation conservation tillage cultivator tillage )2021-04-12v3No1 / 30
149amnoncommon pond, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in zea mays maize pre-crop compared to brassica napus rapeseed pre-crop in soil triticum aestivum germany ph 7.6 bernburg crop rotation conservation tillage cultivator tillage )2021-04-12v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
865amnon high in canis lupus familiaris dog compared to canis lupus wolf in feces china 2022-02-08v3No1 / 35
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in npk fertilization mineral fertilization compared to manured soil manure fertilization organic fertilization in soil bulk soil germany thyrow pot expreiment albic luvisol ph 6.4 lettuce )2021-04-07v3No1 / 38
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
762sheryoHigh in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to manured soil manure fertilization organic fertilization bio-dynamic fertilizer in soil rhizosphere switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 40
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
797amnon high in age 7 months compared to 12-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
149amnonhigher in larvae ever in a pond (original or transferred) compared to only stream ( high in pond compared to stream in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander )2017-04-24v4No1 / 45
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in feces research facility austria captive adult organism 2022-03-12v4No1 / 45
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
638amnoncommon germany, fermented beverage, wine food product, stuttgart2020-08-21v4No1 / 46
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
865amnoncommon feces, canis lupus, china, wolf2022-02-08v3No1 / 51
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
764sheryoHigh in convetional tillage compared to conservation tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in soil triticum aestivum brassica napus germany ph 7.6 bernburg crop rotation rapeseed pre-crop )2021-04-12v3No1 / 52
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in soil triticum aestivum germany ph 7.6 bernburg crop rotation maize pre-crop )2021-04-12v3No1 / 56
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
808amnoncommon research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to high fat diet western diet very high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 60
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in feces research facility austria captive adult organism 2022-03-12v4No1 / 67
764sheryoHigh in conservation tillage compared to conventional tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in soil triticum aestivum brassica napus germany ph 7.6 bernburg crop rotation rapeseed pre-crop )2021-04-12v3No1 / 68
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in sea water bermuda )2016-10-27v4No1 / 71
808amnoncommon research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 72
764sheryoHigh in conventional tillage compared to conservation tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in soil triticum aestivum germany ph 7.6 bernburg crop rotation maize pre-crop )2021-04-12v3No1 / 72
879amnoncommon feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 73
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
820naHigher in 45-5cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 75-105cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 83
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to zea mays maize pre-crop in soil triticum aestivum germany ph 7.6 bernburg loess chernozem conventional tillage mouldboard plough crop rotation )2021-04-12v3No1 / 91
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
149amnon high in pond compared to stream in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 103
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
309amnon high in other plants compared to galium mollugo hedge bedstraw in rhizosphere germany 2018-04-05v4No1 / 110
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 117
792amnon high in rhizosphere haloxylon ammodendron nitraria tangutorum compared to soil in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 118
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in mucus larval stage amphibian larval stage skin germany salamandra salamandra fire salamander )2017-04-24v4No1 / 132
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 139
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
9amnonhigher at end of experiment (grows at later times) ( high in end compared to beginning in sea water bermuda )2016-10-27v4No1 / 158
820naHigher in 75-105cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 45-75cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 159
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in zea mays maize pre-crop compared to brassica napus rapeseed pre-crop in soil triticum aestivum germany ph 7.6 bernburg loess chernozem conventional tillage mouldboard plough crop rotation )2021-04-12v3No1 / 173
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manured soil manure fertilization organic fertilization compared to npk fertilization mineral fertilization in soil bulk soil germany thyrow pot expreiment albic luvisol ph 6.4 lettuce )2021-04-07v3No1 / 176
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 70 days2022-05-20v1No1 / 191
808amnon high in digesta compared to mucosa ileal mucosa in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 192
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 200
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, age 42 days, holstein dairy cow2022-05-20v1No1 / 202
248amnoncommon feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 203
808amnon high in ileum compared to caecum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 224
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 226
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 245
808amnon high in digesta compared to mucosa in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 266
309amnon high in other plants compared to geranium pratense meadow geranium in rhizosphere germany 2018-04-05v4No1 / 267
910amnon high in age 70 days compared to age 140 days in research facility juvenile stage oral cavity mouth mucosa bos taurus germany calve holstein dairy cow 2022-05-20v1No1 / 276
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 294
910amnon high in age 140 days compared to age 70 days in research facility juvenile stage oral cavity mouth mucosa bos taurus germany calve holstein dairy cow 2022-05-20v1No1 / 302
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
879amnoncommon research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 320
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
309amnon high in other plants compared to plantago lanceolata ribwort plantain in rhizosphere germany 2018-04-05v4No1 / 352
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 353
309amnon high in other plants compared to onobrychis viciifolia common sainfoin in rhizosphere germany 2018-04-05v4No1 / 355
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, lettuce, organic fertilization)2021-04-08v3No1 / 359
309amnon high in other plants compared to red fescue grass festuca rubra in rhizosphere germany 2018-04-05v4No1 / 383
309amnon high in other plants compared to veronica chamaedrys germander speedwell in rhizosphere germany 2018-04-05v4No1 / 404
808amnoncommon research facility, caecum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 406
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 443
808amnoncommon research facility, mucosa, caecum, gallus gallus, germany, chicken, age 35 weeks, hen2021-06-20v1No1 / 446
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
910amnoncommon research facility, juvenile stage, rumen, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 510
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
309amnon high in other plants compared to prunella vulgaris woundwort in rhizosphere germany 2018-04-05v4No1 / 550
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, depth (soil) 45-75cm, silty clay loam)2021-07-14v1No1 / 648
309amnon high in meadow pea-vine lathyrus pratensis compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
820naHigher in 45-75cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 0-20cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 686
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, silty clay loam, depth (soil) 75-105cm)2021-07-14v1No1 / 700
808amnon high in mucosa compared to digesta in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 917
820naHigher in 0-20cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 45-75cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 923
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, ph 6.5, silt loam, bonn, haplic luvisol, campus klein-altendorf, depth (soil) 0-20cm)2021-07-14v1No1 / 1011
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
910amnon high in oral cavity mouth mucosa compared to rumen in research facility juvenile stage bos taurus germany calve holstein dairy cow age 140 days 2022-05-20v1No1 / 1194
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
309amnoncommon rhizosphere, germany, meadow pea-vine, lathyrus pratensis2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
910amnon high in rumen compared to oral cavity mouth mucosa in research facility juvenile stage bos taurus germany calve holstein dairy cow age 140 days 2022-05-20v1No1 / 1744
808amnon high in caecum compared to ileum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 1776
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
808amnon high in caecum compared to ileum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 2147

Problems / suggestions? Please email info AT dbbact DOT org