Summary for ontology term: glacial ice

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGAAGAAGGCCTGTGGGTCGTAAACTCCTTTTTTCAGAGAAGAAGTACTGACGGTATCTGAAGAATAAGCTCCGGCTAACTCTGTGCCAGCAGCCGCGG0.666667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGGGAAGAAGGCCTTCGGGTTGTAAACCACTTTTGTACGGAACGAAACGGTCTGCCTTAATACGGTGGGCTAATGACGGTACCGTAAGAATAAGCACCGGC0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGAAGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGCAAGTGACGGTACCTGCAGAAGAAGCACCGGCCAACTACGTGCCAGCAGCCG0.666667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__MethylophilaceaeTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAAGCTCTTTCGCAAGGGAAGAAACGTTACTGGTGAATAACCAGTGATAATGACGGTACCTTGATAAGAAGCACCGGC0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__RhizobacterTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTGGGAAGAAGGCCTTCGGGTTGTAAACCACTTTTGTCAGGGAAGAAACGGTCTGGACTAATAATCTGGGCTAATGACGGTACCTGAAGAATAAGCACCGGC0.666667
d__Bacteria;p__"Proteobacteria"TGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGGGAAGAAGGCCTTCGGGTTGTAAACCACTTTTGTACGGAACGAAACGGTCTGCTTTAATACAGTGGGCTAATGACGGTACCGTAAGAATAAGCACCGGC0.666667
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTAGGGAATATTGGGCAATGGCCGAGAGGCTGACCCAGCCATGCCGCGTGCAGGATGAAGGCTTTCTGAGTCGTAAACTGCTTTTACCAGGGAAGAAAAAAGGGGATGCGTCCCCTACTGACGGTACCTGGTGAATAAGCACCGGCTAACT0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTTGTTGGGGAAGAAAAGCACTGGGTTAATACCTTGGTGTCATGACGGTACCCAAAGAATAAGCACCGGC0.571429
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__FerruginibacterTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGCAGGATGACGGCCCTCTGGGTTGTAAACTGCTTTTATAGGGGACGAAAAAAGGGCTTTCTAGCTCGTCTGACGGTACCCTAGGAATAAGCACCGGCTAACT0.500000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__CytophagaceaeTAGGGAATATTGGGCAATGGTCGAGAGACTGACCCAGCCATGCCGCGTGCAGGATGAAGGCTTTCTGAGTCGTAAACTGCTTTTACCAGGGAAGAAAAAAGGGGATGCGTCCTCTACTGACGGTACCTGGTGAATAAGCACCGGCTAACT0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
glacial ice0.666667
shetland islands0.666667
south shetland glacier0.666667
ice0.500000
glacier0.333333
Fraction of dbbact annotations with this term covered by the query
TermScore
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
ice0.333333
glacier0.200000
Fraction of annotations for the query sequences containing the term
TermScore
glacier1.000000
glacial ice1.000000
ice1.000000
shetland islands1.000000
south shetland glacier1.000000

Problems / suggestions? Please email info AT dbbact DOT org