Summary for ontology term: glacier

Number of annotations with term: 18

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGGGGAATTTTCCGCAATGGGCGCAAGCCTGACGGAGCAATGCCGCGTGGAGGAAGAAGGCTCACGGGTCGTAAACTCCTTTTCTCAGAGAAGAAGACATGACGGTATCTGAGGAATAAGCATCGGCTAACTCTGTGCCAGCAGCCGCGG0.400000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGATGACAGCCTGTGGGTCGTAAACTCCTTTTCTCAGAGAAGAAGTTCTGACGGTATCTGAGGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGG0.400000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATACCGCGTGAGGGACGACGGCTTTTGGGTTGTAAACCTCTTTTCCCTGGGAAGAAGATCTGACGGTACCAGGGGAATCAGCATCGGCTAACTTCGTGCCAGCAGCCGCGG0.400000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCTGCAATGGGCGAAAGCCTGACAGAGCAATACCGCGTGAGGGATGAAGGCCTACGGGTTGTAAACCTCTTTTCTCAAGGAGGAAGATCTGACGTTACTTGAGGAATAAGCATCGGCTAACCCTGTGCCAGCAGCCGCGG0.384615
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGTAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTATTTGTCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.344828
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTAGGGAATATTGGGCAATGGAGGAGACTCTGACCCAGCCATGCCGCGTGCCGGATGAAGGCCTTCTGGGTCGTAAACGGCTTTTTTCCGGGAAGAACCGGTTCTGTGCGCAGGGCTTTGACGGTACCGGGAGAATAAGCACCGGCTAACT0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAGGGACGACGGCCTTCGGGTTGTAAACCTCTTTTAGTAGGGAAGAAGCGTAAAAGTGACGGTACCTGCAGAAAAAGCACCGGCTAACTACGTGCCAGCAGC0.333333
d__Bacteria;p__candidate division WPS-2;g__WPS-2_genera_incertae_sedisTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCGACGCCGCGTGTGGGAAGAAGGCCTTCGGGTCGTAAACCACTGTCGAAGGGGACTATAATGAATGTACCCTTGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.333333
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTGGGGAATTTTCCGCAATGGGCGCAAGCCTGACGGAGCAATACCGCGTGAGGGAGGAAGGCTCTTGGGTCGTAAACCTCTTTTATCAGGGAAGAACACAATGACGGTACCTGATGAATCAGCATCGGCTAACTCTGTGCCAGCAGCCGCG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTGGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTCTTTTGGGACGATAATGACGGTACCAAAGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.333333

Annotations:

common ontology terms
term enrichment score
TermScore
glacier0.888889
ice0.571429
surface0.394366
denali national park and preserve0.307692
stratovolcano0.307692
alaska0.266667
debris0.266667
subsurface0.250000
depth 20-100cm0.250000
snow field0.235294
depth 0-20cm0.222222
filtered 0.2um0.222222
state of oregon0.190476
glacial ice0.181818
shetland islands0.181818
south shetland glacier0.181818
snow0.153846
sweden0.115942
LOWER IN subsurface0.100000
LOWER IN depth 20-100cm0.100000
top of glacier0.100000
LOWER IN terminus of glacier0.100000
terminus of glacier0.100000
LOWER IN top of glacier0.100000
LOWER IN depth 0-20cm0.095238
algae0.086957
LOWER IN surface0.086957
chloroplast0.076923
sediment0.048780
united states of america0.015905
Fraction of dbbact annotations with this term covered by the query
TermScore
glacier0.800000
ice0.666667
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
denali national park and preserve0.500000
top of glacier0.500000
LOWER IN terminus of glacier0.500000
terminus of glacier0.500000
LOWER IN top of glacier0.500000
stratovolcano0.500000
surface0.400000
depth 0-20cm0.333333
LOWER IN depth 0-20cm0.333333
alaska0.333333
debris0.333333
snow field0.250000
snow0.250000
algae0.200000
LOWER IN surface0.200000
filtered 0.2um0.166667
state of oregon0.166667
chloroplast0.125000
sweden0.066667
sediment0.031250
united states of america0.008097
Fraction of annotations for the query sequences containing the term
TermScore
glacier1.000000
ice0.500000
sweden0.444444
united states of america0.444444
surface0.388889
filtered 0.2um0.333333
denali national park and preserve0.222222
alaska0.222222
debris0.222222
snow field0.222222
stratovolcano0.222222
state of oregon0.222222
depth 0-20cm0.166667
subsurface0.166667
depth 20-100cm0.166667
glacial ice0.111111
shetland islands0.111111
south shetland glacier0.111111
snow0.111111
sediment0.111111
chloroplast0.055556
algae0.055556
LOWER IN subsurface0.055556
LOWER IN depth 20-100cm0.055556
LOWER IN surface0.055556
LOWER IN depth 0-20cm0.055556
top of glacier0.055556
LOWER IN terminus of glacier0.055556
terminus of glacier0.055556
LOWER IN top of glacier0.055556
contamination0.055556
Exp. ID User ID Description Date Region Flag Sequences
763amnonalgae chloroplast (other glacier, chloroplast, sweden, algae)2021-04-08v3No1 / 1
224amnondominant united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 14
811amnondominant glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 16
763amnondominant glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 18
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
174amnonhigh freq. in debris covered glacier (dominant united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 19
224amnondominant united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 21
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 74
224amnoncommon united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 87
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
224amnoncommon united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 204
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
174amnoncommon in debris covered glacier (common united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 294
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 310
174amnonhigher farther away from glacier terminus ( high in top of glacier compared to terminus of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 369

Problems / suggestions? Please email info AT dbbact DOT org