Summary for ontology term: glasgow

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGGCCCTGTTCGCTCC1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGGCCTGTTCGCTCCC1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGGCGGCCTGTTCGCT1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerCGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGGTG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeCGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGGTG1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGGCGGAATTCCCCCT1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGCCTGTTCGCTCCCC1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGCCTGTTTGCTACC0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGNNNNNNGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGCAGGCGGTCTGTTAAGTCAGATGTGAAAGGTTAGGGCTCAACCCTGAACGTGCATCTGATACTGGCAGACTTGAGTATGGAAGAGGTAAGTGGAATTCCTAGT0.666667

Annotations:

common ontology terms
term enrichment score
TermScore
glasgow1.000000
crohn's disease0.400000
LOWER IN crohn's disease0.400000
obsolete_juvenile stage0.142857
LOWER IN obsolete_juvenile stage0.142857
child0.050000
LOWER IN child0.050000
adult0.011472
LOWER IN adult0.011299
LOWER IN control0.010582
control0.010582
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
glasgow1.000000
crohn's disease1.000000
LOWER IN crohn's disease1.000000
obsolete_juvenile stage0.100000
LOWER IN obsolete_juvenile stage0.100000
child0.027778
LOWER IN child0.027778
adult0.005780
LOWER IN adult0.005780
LOWER IN control0.005405
control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
glasgow1.000000
adult0.750000
child0.250000
obsolete_juvenile stage0.250000
crohn's disease0.250000
LOWER IN control0.250000
LOWER IN adult0.250000
control0.250000
LOWER IN child0.250000
LOWER IN obsolete_juvenile stage0.250000
LOWER IN crohn's disease0.250000

Problems / suggestions? Please email info AT dbbact DOT org