Summary for ontology term: guangzhou city prefecture

Number of annotations with term: 28

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTG0.285714
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__RhodospirillaceaeTGGGGAATATTGGACACTGGGGGCAACCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTCGGGTTGTAAAGCTCTTTCACACGCGACGATGATGACGGTAGCGTGAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.235294
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTCGGGTTGTAAAGCTCTTTCACCGGGGACGATGATGACGGTACCCGGAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.235294
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATCCCGGGGCTTAACTCCGGAACTGCCTCTAATACTGTTAGACTAGAGAG0.235294
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTC0.235294
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegamonasTACGTAGGCGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAACTAAGCGGATCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGGTCCGAACTGGTTTTCTTGAGTGC0.235294
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTG0.235294
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGACCTTGAGTG0.235294
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTA0.235294
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGCTTAATAAGTCGAGCGTGAAAATGCGGGGCTCAACCCCGTATGGCGCTGGAAACTGTTAGGCTTGAGTGC0.235294

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease1.000000
LOWER IN crohn's disease1.000000
guangzhou city prefecture0.800000
LOWER IN stroke0.500000
stroke0.500000
non-fertilized soil0.333333
saccharum0.333333
sugarcane0.333333
ph 6.70.333333
ph 5.5-60.333333
LOWER IN ph 5.5-60.333333
LOWER IN non-fertilized soil0.333333
LOWER IN ph 6.70.333333
fifth decade human stage0.250000
systemic lupus erythematosus0.250000
LOWER IN systemic lupus erythematosus0.250000
fertilized soil0.250000
LOWER IN fertilized soil0.250000
fourth decade human stage0.142857
ulcerative colitis0.125000
LOWER IN ulcerative colitis0.125000
topsoil0.111111
depth (soil) 0-20cm0.025000
china0.023256
adult0.017341
control0.016216
LOWER IN control0.016216
female0.015873
homo sapiens0.011070
soil0.010101
feces0.009554
Fraction of annotations for the query sequences containing the term
TermScore
guangzhou city prefecture1.000000
china1.000000
feces0.785714
homo sapiens0.785714
adult0.785714
control0.285714
female0.214286
fourth decade human stage0.214286
fifth decade human stage0.214286
soil0.214286
topsoil0.214286
saccharum0.214286
sugarcane0.214286
depth (soil) 0-20cm0.214286
LOWER IN control0.142857
stroke0.107143
ulcerative colitis0.107143
crohn's disease0.107143
systemic lupus erythematosus0.107143
non-fertilized soil0.107143
ph 6.70.107143
fertilized soil0.107143
ph 5.5-60.107143
LOWER IN stroke0.035714
LOWER IN ulcerative colitis0.035714
LOWER IN crohn's disease0.035714
LOWER IN systemic lupus erythematosus0.035714
LOWER IN fertilized soil0.035714
LOWER IN ph 5.5-60.035714
LOWER IN non-fertilized soil0.035714
LOWER IN ph 6.70.035714
Exp. ID User ID Description Date Region Flag Sequences
616amnondominant in topsoil of PK/NP/NPK/NK fertilized sugarcane field (dominant china, soil, fertilized soil, topsoil, guangzhou city prefecture, saccharum, sugarcane, ph 5.5-6, depth (soil) 0-20cm)2020-04-27v3No1 / 2
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
616amnondominant in topsoil of non-fertilized sugarcane field (dominant china, soil, topsoil, guangzhou city prefecture, non-fertilized soil, saccharum, sugarcane, ph 6.7, depth (soil) 0-20cm)2020-04-27v3No1 / 6
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
616amnon high in non-fertilized soil ph 6.7 compared to fertilized soil ph 5.5-6 in soil topsoil guangzhou city prefecture china saccharum sugarcane depth (soil) 0-20cm 2020-04-27v3No1 / 504
616amnon high in fertilized soil ph 5.5-6 compared to non-fertilized soil ph 6.7 in china soil topsoil guangzhou city prefecture saccharum sugarcane depth (soil) 0-20cm 2020-04-27v3No1 / 648
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, china, saccharum, sugarcane, ph 6.7, depth (soil) 0-20cm)2020-04-27v3No1 / 1277
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, china, saccharum, sugarcane, ph 5.5-6, depth (soil) 0-20cm)2020-04-27v3No1 / 1710

Problems / suggestions? Please email info AT dbbact DOT org