Summary for ontology term: high fat diet + inulin

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCGATCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGAAACTGGTGGGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTCG0.250000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTTTTCTTGAGTGTTGGAGAGGAAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGAGTAGGCGGCAAGGTAAGCGATATGTGAAAGCCTTAGGCTTAACCAAAGGATTGCATAACGAACTATCTAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAGCGTTAAGTCAGTGGTCAAATTGAGGGGCTCAACCCCTTCCCGCCATTGAAACTGGCGCTCTTGAGTGGAAGAGAAGTATGCGGAATGCGTGGT0.250000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATCGTTAAGTCAGTGGTCAAATTGAGGGGCTCAACCCCTTCCCGCCATTGAAACTGGCGCTCTTGAGTGGAAGAGAAGTATGCGGAATGCGTGGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTGTTAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGGCGGCCTCGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATTGCAAGTCTGATGTGAAAATCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGTATTTCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTGG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGTTAGGTCGGGGGTCAAATACCGGGGCTCAACCCCGGTCCGCCCCCGATACCGGCAGGCTTGAGTCTGGTAGGGGAAGGCGGAATTCCCAGT0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGCATAGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAGGTCGGGGCCCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGATAACAAGTTAGTTGTGAAACCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTATTCTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAATTTAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTGAATTTCTTGAGTGCGGGAGAGGAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGAGTAGGTGGCAGAGCAAGTCCGAAGTGAAAACCCAAAGCTCAACTATGGGAATGCTTTAGAAACTGCTCAGCTAGAGTGCAGGAGAGGCAAGTGGAATTCTTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATAGCAAGTCTGATGTGAAAACCCGGGGCTCAACTCCGGGAGTGCATTGGAAACTGTTGATCTAGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGATGTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTAAATCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTTTTCTTGAGTGTTGGAGAGGAAAGTGGAATTCCTAG0.300000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTCG0.210526
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__AnaeroglobusTACGTAGGTGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGCAGGCGGCCGGCCAAGTCTGTCTAAAAAGTGCGGGGCTTAACCCCGTGAGGGGAGAGAAACTGGCCGGCTGAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGTTAGGTCGGGGGTCAAATACCGGGGCTCAACCCCGGTCCGCCCCCGATACCGGCAGGCTTGAGTCTGGTAGGGGAAGGCGGAATTCCCAGT0.181818
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAGCGTTAAGTCAGTGGTCAAATTGAGGGGCTCAACCCCTTCCCGCCATTGAAACTGGCGCTCTTGAGTGGAAGAGAAGTATGCGGAATGCGTGGT0.181818
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGGATGTCAAGTCAGCGGTAAAATCGGGAGGCTCAACCTCTCTCAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCAGTTAGGTCGGGAGTCAAATTTCGGGGCTCAACCCCGTCTCGCTCCCGATACCGGCTGGCTTGAGTGTGGTAGGGGAAGGCGGAATTCCCGGT0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCGATCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGAAACTGGTGGGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.122449
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCAAGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCTTGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.105263
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGAGTTCGTAGGCGGTTTGTTAAGTCTAAAATTCAAGCCCGAGGCTTAACCTCGGTTCGTTTTAGAAACTGGCAAACTTGAGTGTGGTAGAGGCAAGTGGAATTTCTAGT0.105263

Annotations:

common ontology terms
term enrichment score
TermScore
high fat diet + inulin0.600000
LOWER IN high fat diet + inulin0.333333
LOWER IN low fat diet0.285714
low fat diet0.285714
jackson laboratories0.285714
state of georgia0.222222
LOWER IN mouse chow0.105263
mouse chow0.105263
c57bl/60.105263
mouse0.034483
mus musculus0.031250
research facility0.013514
united states of america0.008065
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
high fat diet + inulin0.500000
LOWER IN high fat diet + inulin0.500000
LOWER IN low fat diet0.333333
low fat diet0.333333
jackson laboratories0.166667
state of georgia0.125000
LOWER IN mouse chow0.066667
mouse chow0.066667
c57bl/60.055556
mouse0.017544
mus musculus0.015873
research facility0.006803
united states of america0.004049
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
mus musculus1.000000
c57bl/61.000000
state of georgia1.000000
mouse1.000000
jackson laboratories1.000000
high fat diet + inulin0.750000
LOWER IN low fat diet0.250000
LOWER IN mouse chow0.250000
low fat diet0.250000
mouse chow0.250000
LOWER IN high fat diet + inulin0.250000

Problems / suggestions? Please email info AT dbbact DOT org