Summary for ontology term: hispanic or latin american

Number of annotations with term: 30

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTCCGGGTTGTAAACTGCTTTTAGTTGGGAATAAAAAAAGGGACGTGTCCCTTATTGTATGTACCTTCAGAAAAAGGACCGGCTAATT0.068966
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGGTGTAAGCCTGATCCAGCCATCCCGCGTGAAGGAAGACGGTTCTATGGATTGTAAACTTCTTTTATACAGGGATAAACCTACCCTCGTGAGGGTAGCTGAAGGTACTGTATGAATAAGCACCGGCTAACT0.034483
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAGAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.034483
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGAAGGTCCTGCTCTTTGTGGTGGGGTTGACGGTAGCTGGGTTAATGAAGCGCCGGCTA0.034483
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaGTAAGAATATTCCGCAATGGGGGGAACCCTGACGGAGCGACGCCGCGTGAACGAAGAAGGCCGGAAGGTTGTAAAGTTCTTTTCTGTCCGAGGAATAAGTGTAGGAGGAAATGCCTGCATGGTGACGGTAGGGCAGGAATAAGCACCGGC0.034483
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGCAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.034483
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGCAGGCCTGCCTCGTTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAA0.034483
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTGAGTTACGTGTAACTTATTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.034483
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTTTTAGGCAATGACGGTACCCATCGAGGAAGCCACGG0.034483
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__PropionibacteriaceaeTGGGGAATATTGCACAATGGACGGAAGTCTGATGCAGCAACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTCATCCATGACGAAGCTTTTGTGACGGTAGTGGGTAAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.034483

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGAAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGTAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTGTATGGGGATAAAGTCAGTCACGTGTGATTGTTTGCAGGTACCATACGAATAAGGACCGGCTAATT0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTGCAGAACGAAAAGGGCTTGGCTAATACCTAAGTCTGATGACGGTACTGCAAGAATAAGCACCGGC0.333333
d__BacteriaTGAGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCGACACCGCGTGAAGGAAGAAGGCCTAACGGTTGTAAACTTCTTTTCTGAAGGAGCATAATGAGAGTACTTTAGGAATAAGGGACGGCTAAATACGTGCCAGCAGCCGCGGTA0.333333
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGCGTGGATGATGAAGGTCGGAAGATTGTAAAATCCTTTTATGACTGAAGAATAAGTATGGTGAGAGAAACGCCGTATGGTGACAGTAGGTCATGAATAAGCAACGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGGGTATTGCACAATGGGCGGAAGCCTGATGCAGCGACGTCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCTCCGGTGGTGAAGGCCCCGCCCTTGGTGGTGGGGTTGACGGTAGCCGGGTATGAAGCGCCGGCTAAC0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAATGTACGGAGTGCGAATAGTGCTCTGTAATGACGGTACCTATCGAGGAAGCCACGG0.333333
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGTGTGAATGAAGAAGGCCGAAAGGTTGTAAAATTCTTTTGCAGATGAAGAATAATCATAGGAGGGAATGCCTGTGAGATGACGGTAATCATGCGAATAAGCCCCGG0.333333
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGTCAATGGTCGAAAGACTGAACCAGCCATGCCGCGTGCAGGACAGACGGCCCTAGAGGTTGTAAACTGCTTTTATATGGGAAGAATAAGGAGTACGCGTACTTTGATGACGGTACCATATGAATAAGCATCGGCTAAC0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTCGGGGACGAAAGGGTAGACGAGGTAATGCGTTTACTAAGACGGTACCCGACGAGGAAGCCACGGC0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.173913
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTCCGGGTTGTAAACTGCTTTTAGTTGGGAATAAAAAAAGGGACGTGTCCCTTATTGTATGTACCTTCAGAAAAAGGACCGGCTAATT0.150000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.114943
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.113208
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGTTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.111111
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGAGATCAAGTCAGTTGTGAAAAGCAGCCGCTCAACGGTTGTCGTGCAGTTGATACTGGTTTTCTTGAGTGCGCGCGAGGATGGTGGAATTTGTGG0.102564
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGACAATGGTCGGAAGACTGATCCAGCCATGCCGCGTGCAGGAAGACGGCCTTATGGGTTGTAAACTGCTTTTGCAGGGGAAGAATAAGGACTACGAGTAGTTTGATGACGGTACTCTGCGAATAAGCATCGGCTAACT0.101695
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTTTTAGGCAATGACGGTACCCATCGAGGAAGCCACGG0.098361
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCATAAAGTGGGCGGAATTCGTGG0.090909

Annotations:

common ontology terms
term enrichment score
TermScore
hispanic or latin american0.831683
hispanic0.592593
los angeles district0.571429
6-year-old human stage0.285714
8-year-old human stage0.285714
9-year-old human stage0.285714
10-year-old human stage0.285714
11-year-old human stage0.285714
7-year-old human stage0.250000
state of nebraska0.222222
6-month-old human stage0.215385
formula fed0.200000
breast fed0.200000
1-month-old human stage0.166667
supragingival dental plaque0.166667
supragingival plaque0.133333
LOWER IN hispanic0.111111
LOWER IN hispanic or latin american0.105263
dentition0.071429
infant0.070175
state of california0.070175
LOWER IN cuba0.064516
cuba0.064516
LOWER IN burmese0.062500
burmese0.062500
non usa born0.062500
LOWER IN usa born0.062500
usa born0.062500
LOWER IN non usa born0.062500
LOWER IN asian0.060606
asian0.060606
LOWER IN caucasian0.058824
LOWER IN european0.058824
caucasian0.058824
european0.058824
LOWER IN breast fed0.058824
LOWER IN formula fed0.058824
LOWER IN 6-month-old human stage0.057143
LOWER IN 1-month-old human stage0.055556
mexico0.052632
LOWER IN mexico0.052632
old age0.051282
LOWER IN young age0.051282
young age0.051282
LOWER IN old age0.051282
low bmi0.051282
LOWER IN low bmi0.051282
LOWER IN body mass index0.048780
body mass index0.048780
child0.048780
LOWER IN high bmi0.046512
high bmi0.046512
age0.039216
male0.031746
LOWER IN male0.031746
homo sapiens0.021898
LOWER IN female0.021505
female0.021505
united states of america0.015979
feces0.012638
adult0.011396
Fraction of dbbact annotations with this term covered by the query
TermScore
los angeles district1.000000
LOWER IN cuba1.000000
cuba1.000000
hispanic or latin american0.750000
hispanic0.666667
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
LOWER IN burmese0.500000
burmese0.500000
non usa born0.500000
LOWER IN usa born0.500000
usa born0.500000
LOWER IN non usa born0.500000
7-year-old human stage0.333333
LOWER IN hispanic0.333333
LOWER IN asian0.333333
asian0.333333
formula fed0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
state of nebraska0.250000
caucasian0.250000
european0.250000
LOWER IN hispanic or latin american0.250000
LOWER IN breast fed0.250000
breast fed0.250000
LOWER IN formula fed0.250000
6-month-old human stage0.200000
LOWER IN 6-month-old human stage0.200000
1-month-old human stage0.166667
LOWER IN 1-month-old human stage0.166667
supragingival dental plaque0.142857
mexico0.125000
LOWER IN mexico0.125000
old age0.111111
LOWER IN young age0.111111
young age0.111111
LOWER IN old age0.111111
low bmi0.111111
LOWER IN low bmi0.111111
supragingival plaque0.100000
LOWER IN body mass index0.090909
body mass index0.090909
LOWER IN high bmi0.076923
high bmi0.076923
age0.047619
dentition0.043478
infant0.038462
state of california0.038462
male0.030303
LOWER IN male0.030303
child0.027778
LOWER IN female0.015873
female0.015873
homo sapiens0.011070
united states of america0.008097
feces0.006369
adult0.005780
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
hispanic or latin american0.933333
feces0.800000
united states of america0.600000
hispanic0.533333
infant0.400000
state of california0.400000
los angeles district0.400000
adult0.400000
6-month-old human stage0.233333
dentition0.200000
child0.200000
state of nebraska0.200000
supragingival plaque0.200000
supragingival dental plaque0.200000
6-year-old human stage0.200000
7-year-old human stage0.200000
8-year-old human stage0.200000
9-year-old human stage0.200000
10-year-old human stage0.200000
11-year-old human stage0.200000
formula fed0.166667
1-month-old human stage0.166667
breast fed0.166667
LOWER IN hispanic or latin american0.066667
LOWER IN hispanic0.066667
LOWER IN 6-month-old human stage0.033333
LOWER IN 1-month-old human stage0.033333
LOWER IN caucasian0.033333
LOWER IN european0.033333
caucasian0.033333
european0.033333
LOWER IN asian0.033333
LOWER IN burmese0.033333
asian0.033333
burmese0.033333
male0.033333
LOWER IN female0.033333
female0.033333
LOWER IN male0.033333
age0.033333
old age0.033333
LOWER IN young age0.033333
young age0.033333
LOWER IN old age0.033333
low bmi0.033333
LOWER IN body mass index0.033333
LOWER IN high bmi0.033333
body mass index0.033333
high bmi0.033333
LOWER IN low bmi0.033333
non usa born0.033333
LOWER IN usa born0.033333
usa born0.033333
LOWER IN non usa born0.033333
mexico0.033333
LOWER IN cuba0.033333
cuba0.033333
LOWER IN mexico0.033333
LOWER IN breast fed0.033333
LOWER IN formula fed0.033333
Exp. ID User ID Description Date Region Flag Sequences
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 5
644amnonpositively correalted with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 7
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 10
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 13
658amnon high in hispanic or latin american hispanic compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 17
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 21
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
859amnon high in breast fed compared to formula fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 25
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
644amnon high in male compared to female in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 58
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 93
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 118
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136

Problems / suggestions? Please email info AT dbbact DOT org