Summary for ontology term: holstein dairy cow

Number of annotations with term: 24

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTATGCAAGTCTGAAGTGAAAACCAGGGGCTTAACTCCTGGATTGCTTTGGAAACTGTGTAGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.086957
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.086957
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.086957
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGCAAGTCAGTCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGATTGAAACTGTCTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.086957
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTACGTAGGGTCCAAGCATTATCCGGATTGACTGGGTGTAAAGAGTTGCGTAGGTGGCAGGGTAAGTAGATAGTGAAATCTGGTGGCTCAACCATTCAGACTATTATCTAAACTGCTCCGCTCGAGAGCGTTAGGGGTAGCTGGAATTTCT0.086957
d__BacteriaTACGTAGGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGACGGCGATGCAAGTCAGATGTGAAATGCTAGGGCTTAACCTTAGAACTGCATCTGAAACTGTATTGCTAGAGTGCAGGAGAGGTAAACGGAATTCCTAG0.086957
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGGATGACTTGAGTACGCGGGAAGCAGGCGGAATTCGTCG0.086957
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGTTTGATAAGTCTAAGATCTAAGCCCGAAGCTTAACTTCGGTTCGTCTTAGAAACTGTCTTACTTGAGCATGGTAGAGGCAAGTGGAATTTCTAGT0.086957
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGTTTGATAAGTCTGTGGTTTAAGCCCGAAGCTTAACTTCGGTTCGCCACAGAAACTGTCAGACTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.086957
d__BacteriaTACGTAGGGTCCAAGCATTATCCGGATTGACTGGGTGTAAAGAGTTGCGTAGGTGGACAGTTAAGTAGGTAGTGAAATCTGGTGGCTCAACCATTCAGACTATTACCTAAACTGATTGTCTCGAGAATGTTAGGGGTAGCTGGAATTTCT0.086957

Top negative-associated sequence

Taxonomy Sequence Recall
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCTGTTTTTATTGGGCCTAAAGCGTTCGTAGCCGGTTTGATAAGTCACTGGTGAAATCCTGTAGCTTAACTGTGGGAATTGCTGGTGATACTGTTGAACTTGAGGTCGGGAGAGGTTAGCGGTACTCCCA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XIII;g__MogibacteriumTACGTATGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCGCAAGGTTTAATCTTGAGGCTCAACCTCATTCTGCCTTGCGAACTGGGCTACTTGAGTGCAGGAGGGGAAAGCGGAATTCCCAGT0.666667
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGTTTTCAAGATGGGAATTGCTTTGGATACTGATGGGCTTGAGTGCAGGAGAGGTTATCGGAATTCCCGG0.666667
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCAATTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGTAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGACCGGGAGAGGTTAGAGGTACTCCCA0.666667
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTACGTAGGGTCCAAGCATTATCCGGATTGACTGGGTGTAAAGAGTTGCGTAGGTGGCAGGGTAAGTAGATAGTGAAATCTGGTGGCTCAACCATTCAGACTATTATCTAAACTGCTCCGCTCGAGAACGTTAGGGGTAGCTGGAATTTCT0.666667
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeGACGAACTGTCCAAACGTTATTCGGAATCACTGGGCTTAAAGGGTGCGTAGGCGGACCTGCAAGTGGGATCTGAAATCCCTCGGCTCAACCGAGGAACTGGGTCCCAAACTGCCGGACTAGAGTGAGACAGGGGTAAGTGGAACTTGCGG0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGTTCTTTAAGTTTGGAGTGAAAGTCCTGTTTTTAAGGTGGGAATTGCTTTGAATACTGGAGAACTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATGCAAGTCTGATGTGAAAACCCGGGGCTCAACCGCGGGATTGCATTGGAAACTGTATAGCTCGAGTACTGGAGGGGCAGGCGGAATTCCTGG0.666667
d__BacteriaTACAGAGGCCCGTAGCGTTGTTCGGATTTACTGGGCGTAAAGGGTACGTAGGCGGCGGGGCGTGTCGAGTGTGAAATCTCCGGGCTCAACCCGGAAAGTGCGCTCGAAACTACCCCGCTGGAGGCCGGGAGAGGGAAGGGGAATGCAGGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTGCAGCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAGCGGATGAAAGTAGCTTGCTACTGGATTCAGCGGCGGACGGGTGAGTAATGCTTAGGAATCTGCCTATTAGTGGGGGACAACATCTCGAAAGGGATGCTAATACCGCATACG0.451613
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGATGAAGACCCTGCTTGCAGGGTTGGATTAGTGGCGAACGGGTGAGTAATACGTGAGTAACCTGCCTTTAACTCTGGGATAAGCCTTGGAAACGAGGTCTAATACCGGAT0.451613
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAACGGTAGCACAGAGGAGCTTGCTCCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGCTTGGGAATCTGGCTTATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCG0.451613
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGGAGCACCTTGGTGCTCAGTGGCGAACGGGTGAGGAGAACATAGGTAACCTGCCCCTCCGAGGGGGACAACAGCTGGAAACGGCTGCTAAGACCGCATAGACGCATTCAG0.451613
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAACGATGATGTCTAGCTTGCTAGACTGATTAGTGGCGAACGGGTGAGTAATGCTTAGGAATCTGCCTGGTAGTGGGGGACAACATTCCGAAAGGAATGCTAATACCGCATACG0.400000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeATTGAACGCTGGCGGCATGCTTTACACATGCAAGTCGGACGGCAGCGAGGGAGTGCTTGCACTTCTGTCGGCGAGTGGCGAACGGGTGAGTAATGCATTGGAACGTACCGAGTAGTGGGGGATAACTGTCCGAAAGGATAGCTAATACCG0.400000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeATTGAACGCTGGCGGCATGCTTTACACATGCAAGTCGGACGGCAGCGGGGGTGCTTGCACCTGCCGGCGAGTGGCGAACGGGTGAGTAATGCATTGGAACGTACCGAGTAGTGGGGGATAACTATCCGAAAGGATAGCTAATACCGCATA0.400000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGTACGGACCGCTTCGGCGGTCAGTGGCGAACGGGTGAGGACAACATAGGTAACCTGCCCCTCCGAGGGGGACAACAGCTGGAAACGGCTGCTAAGACCGCATAGACGTGCAGGA0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__RuminobacterATTGAACGCTGGCGGCAGGCTTAATACATGCAAGTCGAACGGTAACAGCAGGAAGCTTGCTTCCTGGCTGACGAGTGGCGGACGGGTGAGTAATACCTGGGGAGCTGCCTGAATGAGGGGGACAACACCTGGAAACGGGTGCTAATACCG0.387097
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__PsychrobacterATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAGCGGAAACGATGATAGCTTGCTATCAGGCGTCGAGCGGCGGACGGGTGAGTAATACTTAGGAATCTACCTAGTAGTGGGGGATAGCTCGGGGAAACTCGAATTAATACCGCA0.363636

Annotations:

common ontology terms
term enrichment score
TermScore
holstein dairy cow0.825000
calve0.400000
state of mississippi0.400000
juvenile stage0.333333
age 140 days0.311111
bos taurus0.285714
rumen0.203077
age 70 days0.181818
shandong province0.181818
rumen liquid0.181818
mouth mucosa0.157895
ruminal fluid0.153846
cow0.142857
LOWER IN jersey cow0.142857
jersey cow0.142857
age 42 days0.133333
LOWER IN holstein dairy cow0.125000
female organism0.117647
oral cavity0.113208
LOWER IN high milk yield0.076923
low milk yield0.076923
LOWER IN low milk yield0.076923
high milk yield0.076923
LOWER IN age 140 days0.074074
LOWER IN age 70 days0.074074
germany0.058824
LOWER IN mouth mucosa0.058824
LOWER IN oral cavity0.051282
LOWER IN rumen0.042553
research facility0.036364
china0.010471
united states of america0.007634
feces0.005698
Fraction of dbbact annotations with this term covered by the query
TermScore
holstein dairy cow0.750000
LOWER IN jersey cow0.500000
state of mississippi0.500000
jersey cow0.500000
LOWER IN high milk yield0.500000
low milk yield0.500000
LOWER IN low milk yield0.500000
high milk yield0.500000
age 70 days0.333333
calve0.333333
LOWER IN age 140 days0.333333
LOWER IN age 70 days0.333333
age 140 days0.333333
age 42 days0.333333
juvenile stage0.250000
LOWER IN holstein dairy cow0.250000
shandong province0.200000
rumen liquid0.200000
bos taurus0.166667
ruminal fluid0.142857
rumen0.130435
mouth mucosa0.100000
LOWER IN mouth mucosa0.100000
cow0.090909
female organism0.071429
oral cavity0.066667
LOWER IN oral cavity0.066667
LOWER IN rumen0.043478
germany0.031250
research facility0.018519
china0.005405
united states of america0.003861
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
bos taurus1.000000
research facility1.000000
holstein dairy cow0.916667
calve0.500000
germany0.500000
juvenile stage0.500000
rumen0.458333
mouth mucosa0.375000
oral cavity0.375000
united states of america0.333333
state of mississippi0.333333
female organism0.333333
cow0.333333
age 140 days0.291667
feces0.166667
ruminal fluid0.166667
shandong province0.166667
china0.166667
rumen liquid0.166667
age 70 days0.125000
LOWER IN jersey cow0.083333
LOWER IN holstein dairy cow0.083333
jersey cow0.083333
age 42 days0.083333
LOWER IN age 140 days0.041667
LOWER IN age 70 days0.041667
LOWER IN high milk yield0.041667
low milk yield0.041667
LOWER IN low milk yield0.041667
high milk yield0.041667
LOWER IN rumen0.041667
LOWER IN mouth mucosa0.041667
LOWER IN oral cavity0.041667
Exp. ID User ID Description Date Region Flag Sequences
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, rumen, juvenile stage, research facility2022-05-20v1No1 / 6
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 9
910amnondominant age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 10
748amnondominant holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
910amnondominant holstein dairy cow, age 42 days, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 15
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 16
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
910amnoncommon age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 191
910amnoncommon age 42 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 202
910amnoncommon mouth mucosa, oral cavity, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 245
910amnon high in age 70 days compared to age 140 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 276
910amnon high in age 140 days compared to age 70 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 302
748amnon high in jersey cow compared to holstein dairy cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 308
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
748amnon high in holstein dairy cow compared to jersey cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 407
910amnoncommon rumen, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 510
748amnoncommon holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 577
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
748amnon high in jersey cow compared to holstein dairy cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 603
748amnoncommon holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 614
748amnon high in holstein dairy cow compared to jersey cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 638
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v1No1 / 1194
910amnon high in rumen compared to mouth mucosa oral cavity in age 140 days holstein dairy cow calve germany bos taurus juvenile stage research facility 2022-05-20v1No1 / 1744

Problems / suggestions? Please email info AT dbbact DOT org