Summary for ontology term: human adult stage

Number of annotations with term: 163

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.030488
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGATGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.030488
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.024390
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGATGGCAAGTCAGATGTGAAATACCGGGGCTTAACCCCGGGGCTGCATTTGAAACTGTCGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCTGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.024390

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.117647
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.117647
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.117647
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.117647
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.117647
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAACTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGGCTGGAACTCCTGG0.117647
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTCAATTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.117647

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGATAGTGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.214067
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.213699
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTAGGGAATTTTCGGCAATGGGGGAAACCCTGACCGAGCAACGCCGCGTGAAGGAAGAAGTAATTCGTTATGTAAACTTCTGTCATAGAGGAAGAACGGTGGATATAGGGAATGATATCCAAGTGACGGTACTCTATAAGAAAGCCACGGC0.193277
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGATAATGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTA0.186186
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGG0.185430
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTGGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAAGGATGAAGTATTTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.183908
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTGAGGCACGTGTGCCTTTTTGTATGTACCGTATGAATAAGGATCGGCTAACT0.183381
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.178571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGGATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.174699
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGT0.173913

Annotations:

common ontology terms
term enrichment score
TermScore
human adult stage0.499468
adult0.284087
fourth decade human stage0.256684
homo sapiens0.220993
human late adulthood stage0.177700
feces0.166058
third decade human stage0.147727
fifth decade human stage0.134078
rural community0.130638
kingdom of the netherlands0.120603
gestational diabetes0.115607
female0.098223
ninth decade human stage0.091429
united states of america0.088717
human early adulthood stage0.079867
saliva0.079734
commonwealth of massachusetts0.071979
iga positive fraction0.071006
LOWER IN iga negative fraction0.071006
iga negative fraction0.071006
LOWER IN iga positive fraction0.071006
china0.070938
65-79 year-old human stage0.069767
LOWER IN fourth decade human stage0.069164
nanning city prefecture0.068571
sixth decade human stage0.068571
nanjing city prefecture0.066298
toronto0.066298
multiple sclerosis0.066298
control0.065501
ulcerative colitis0.064171
amsterdam0.064171
tanzania0.064171
guangzhou city prefecture0.062176
japan0.061920
canada0.060837
south korea0.060302
italy0.060086
turin township0.059524
80 year-old and over human stage0.057803
caribbean latino0.057803
young adult stage0.056980
state of texas0.056872
zhejiang province0.053812
intestinal mucosa0.053191
jiangsu province0.052402
biopsy0.049261
commonwealth of pennsylvania0.048077
urban community0.047904
botswana0.047904
LOWER IN 65-79 year-old human stage0.047337
LOWER IN ninth decade human stage0.047337
LOWER IN fifth decade human stage0.046784
oslo0.046784
age >940.046784
tenth decade human stage0.046784
rectum0.045872
human middle aged stage0.045714
pregnancy0.044843
seoul0.044693
LOWER IN ulcerative colitis0.044693
obesity0.041885
austria0.041885
kingdom of norway0.041026
LOWER IN control0.039056
high bmi0.037209
south africa0.036530
spinal cord injury0.036145
eleventh decade human stage0.035503
centenarian human stage0.035503
nephrolithiasis0.035503
bushbuckridge local municipality0.035503
peri-urban community0.035503
third trimester0.035503
before antibiotics0.035503
parkinson's disease0.034286
vancomycin0.034286
systemic lupus erythematosus0.034286
africa0.034261
male0.033241
city0.031088
antibiotic0.028436
skin0.027119
LOWER IN urban community0.024242
LOWER IN crohn's disease0.024242
crohn's disease0.024242
auckland city0.024242
LOWER IN botswana0.024242
postmenopausal0.024242
buffalo0.024242
saen thong subdistrict0.024242
LOWER IN 25-44 year-old human stage0.024096
25-44 year-old human stage0.024096
oesophageal brush0.023952
17-29-years-old human0.023952
20-year-old human stage0.023952
LOWER IN age >940.023952
LOWER IN tenth decade human stage0.023952
non-celiac gluten sensitivity0.023952
stimulated saliva0.023952
Fraction of dbbact annotations with this term covered by the query
TermScore
fourth decade human stage1.000000
spinal cord injury1.000000
third decade human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
iga positive fraction1.000000
LOWER IN iga negative fraction1.000000
iga negative fraction1.000000
LOWER IN iga positive fraction1.000000
LOWER IN spinal cord injury1.000000
LOWER IN urban community1.000000
urban community1.000000
LOWER IN crohn's disease1.000000
crohn's disease1.000000
gestational diabetes1.000000
turin township1.000000
auckland city1.000000
LOWER IN botswana1.000000
botswana1.000000
postmenopausal1.000000
buffalo1.000000
saen thong subdistrict1.000000
fifth decade human stage0.750000
LOWER IN 65-79 year-old human stage0.666667
65-79 year-old human stage0.666667
LOWER IN 25-44 year-old human stage0.666667
LOWER IN ninth decade human stage0.666667
ninth decade human stage0.666667
25-44 year-old human stage0.666667
human adult stage0.636364
human late adulthood stage0.600000
LOWER IN fourth decade human stage0.571429
LOWER IN fifth decade human stage0.500000
oesophageal brush0.500000
17-29-years-old human0.500000
oslo0.500000
20-year-old human stage0.500000
soldiers0.500000
LOWER IN age >940.500000
LOWER IN tenth decade human stage0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
non-celiac gluten sensitivity0.500000
stimulated saliva0.500000
eleventh decade human stage0.500000
centenarian human stage0.500000
80 year-old and over human stage0.500000
LOWER IN eleventh decade human stage0.500000
LOWER IN centenarian human stage0.500000
LOWER IN 80 year-old and over human stage0.500000
skin of forehead0.500000
caribbean latino0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
nephrolithiasis0.500000
bushbuckridge local municipality0.500000
peri-urban community0.500000
LOWER IN soweto0.500000
soweto0.500000
LOWER IN bushbuckridge local municipality0.500000
LOWER IN peri-urban community0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
third trimester0.500000
province of alberta0.500000
before antibiotics0.500000
LOWER IN before antibiotics0.500000
hadza0.500000
LOWER IN hadza0.500000
young adult stage0.400000
nanjing city prefecture0.333333
toronto0.333333
multiple sclerosis0.333333
LOWER IN multiple sclerosis0.333333
human middle aged stage0.333333
athlete0.333333
clostridium difficile colitis0.333333
kingdom of the netherlands0.333333
village0.333333
rural community0.272727
parkinson's disease0.250000
LOWER IN parkinson's disease0.250000
esophagus0.250000
LOWER IN third decade human stage0.250000
age 1 year0.250000
LOWER IN age 1 year0.250000
state of arizona0.250000
seoul0.250000
skin of cheek0.250000
LOWER IN type 2 diabetes mellitus0.250000
type 2 diabetes mellitus0.250000
LOWER IN ulcerative colitis0.250000
ulcerative colitis0.250000
clostridium difficile infection0.250000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.926380
feces0.822086
adult0.785276
human adult stage0.411043
united states of america0.282209
china0.276074
fourth decade human stage0.147239
control0.134969
female0.128834
human late adulthood stage0.104294
rural community0.085890
third decade human stage0.079755
fifth decade human stage0.073620
saliva0.073620
kingdom of the netherlands0.073620
japan0.061350
gestational diabetes0.061350
human early adulthood stage0.049080
LOWER IN control0.049080
canada0.049080
ninth decade human stage0.049080
africa0.049080
italy0.042945
commonwealth of massachusetts0.042945
nanjing city prefecture0.036810
LOWER IN fourth decade human stage0.036810
south korea0.036810
65-79 year-old human stage0.036810
toronto0.036810
iga positive fraction0.036810
LOWER IN iga negative fraction0.036810
state of texas0.036810
iga negative fraction0.036810
LOWER IN iga positive fraction0.036810
jiangsu province0.036810
zhejiang province0.036810
multiple sclerosis0.036810
nanning city prefecture0.036810
sixth decade human stage0.036810
ulcerative colitis0.036810
male0.036810
amsterdam0.036810
tanzania0.036810
guangzhou city prefecture0.036810
young adult stage0.030675
80 year-old and over human stage0.030675
caribbean latino0.030675
rectum0.030675
biopsy0.030675
intestinal mucosa0.030675
pregnancy0.030675
turin township0.030675
commonwealth of pennsylvania0.030675
LOWER IN fifth decade human stage0.024540
LOWER IN 65-79 year-old human stage0.024540
kingdom of norway0.024540
oslo0.024540
LOWER IN ninth decade human stage0.024540
age >940.024540
tenth decade human stage0.024540
skin0.024540
seoul0.024540
LOWER IN ulcerative colitis0.024540
south africa0.024540
human middle aged stage0.024540
urban community0.024540
obesity0.024540
high bmi0.024540
botswana0.024540
austria0.024540
spinal cord injury0.018405
parkinson's disease0.018405
LOWER IN adult0.018405
city0.018405
eleventh decade human stage0.018405
centenarian human stage0.018405
nephrolithiasis0.018405
bushbuckridge local municipality0.018405
peri-urban community0.018405
third trimester0.018405
before antibiotics0.018405
antibiotic0.018405
vancomycin0.018405
systemic lupus erythematosus0.018405
age0.012270
LOWER IN human late adulthood stage0.012270
state of california0.012270
state of florida0.012270
esophagus0.012270
australia0.012270
oesophageal brush0.012270
LOWER IN 25-44 year-old human stage0.012270
midwest region0.012270
dentition0.012270
supragingival plaque0.012270
supragingival dental plaque0.012270
LOWER IN saliva0.012270
LOWER IN dentition0.012270
LOWER IN supragingival plaque0.012270
LOWER IN supragingival dental plaque0.012270
Exp. ID User ID Description Date Region Flag Sequences
131amnonpositively correlated with age (30-80 years) ( high in age human late adulthood stage compared to fourth decade human stage fifth decade human stage in feces homo sapiens south korea )2017-04-16v4No1 / 1
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 2
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in feces homo sapiens adult kingdom of the netherlands human adult stage 2022-02-18v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 2
877amnon high in low breath methane content compared to high breath methane content in feces homo sapiens adult austria human early adulthood stage 2022-03-08v4No1 / 2
803amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens united states of america adult commonwealth of massachusetts caribbean latino human late adulthood stage 2021-06-18v4No1 / 3
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 4
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 5
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 6
841amnon high in iga negative fraction compared to iga positive fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 7
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 8
847amnon high in 25-44 year-old human stage compared to 80 year-old and over human stage ninth decade human stage in feces japan 2021-12-01v1No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 9
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in feces japan 2021-12-01v1No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 10
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 11
861amnondominant feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 11
847amnondominant feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 12
873amnondominant feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 12
847amnondominant feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 13
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
873amnondominant feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 14
846amnondominant homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 15
847amnondominant feces, japan, human early adulthood stage2021-12-01v1No1 / 15
873amnondominant feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
884amnondominant feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 16
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
849amnondominant feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 17
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 17
885amnondominant feces, homo sapiens, united states of america, state of florida, human early adulthood stage2022-03-26v3No1 / 18
892amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 18
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
874amnondominant homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 18
875amnondominant feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 18
880amnondominant feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 18
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
438amnondominant feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens adult male kingdom of the netherlands amsterdam before antibiotics human adult stage 2022-02-19v3No1 / 19
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
869amnondominant feces, homo sapiens, obesity, adult, kingdom of the netherlands, high bmi, human adult stage2022-02-18v3No1 / 20
911amnondominant feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v3No1 / 21
870amnondominant feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 21
877amnondominant feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v4No1 / 21
911amnon high in spinal cord injury compared to control in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 21
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
841amnondominant feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 23
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 24
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
911amnondominant feces, homo sapiens, nanjing city prefecture, spinal cord injury, china, human adult stage2022-05-21v4No1 / 25
856amnondominant homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in feces homo sapiens adult kingdom of the netherlands human adult stage 2022-02-18v3No1 / 26
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 28
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens obesity adult kingdom of the netherlands high bmi human adult stage 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens adult male kingdom of the netherlands amsterdam before antibiotics human adult stage 2022-02-19v3No1 / 30
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
871amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 35
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
873amnon high in hunter gatherer hadza compared to maasai sandawe burunge in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 37
866amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 40
871amnonlower before antibiotic treatment compared to after treatment ( high in antibiotic vancomycin compared to before antibiotics in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 44
869amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens obesity adult kingdom of the netherlands high bmi human adult stage 2022-02-18v3No1 / 45
873amnon high in maasai sandawe burunge compared to hunter gatherer hadza in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 46
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 48
869amnoncommon feces, homo sapiens, obesity, adult, kingdom of the netherlands, high bmi, human adult stage2022-02-18v3No1 / 48
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
911amnoncommon feces, homo sapiens, nanjing city prefecture, spinal cord injury, china, human adult stage2022-05-21v4No1 / 51
847amnoncommon feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 52
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 52
847amnoncommon feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 54
847amnoncommon feces, japan, human early adulthood stage2021-12-01v1No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 56
866amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 58
877amnon high in high breath methane content compared to low breath methane content in feces homo sapiens adult austria human early adulthood stage 2022-03-08v4No1 / 58
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
875amnoncommon feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 65
874amnoncommon homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 67
846amnoncommon homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
870amnoncommon feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 71
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
873amnon high in tanzania rural community botswana compared to united states of america commonwealth of pennsylvania urban community in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 73
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
880amnoncommon feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 79
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 81
873amnoncommon feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 85
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
892amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 88
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 92
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
877amnoncommon feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v4No1 / 102
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
873amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 112
861amnoncommon feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
873amnoncommon feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 125
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
885amnoncommon feces, homo sapiens, united states of america, state of florida, human early adulthood stage2022-03-26v3No1 / 152
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 157
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
861amnon high in city soweto urban community compared to rural community bushbuckridge local municipality peri-urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 185
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 205
873amnon high in botswana compared to tanzania in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 226
873amnon high in united states of america commonwealth of pennsylvania urban community compared to tanzania africa rural community botswana in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 227
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to antibiotic vancomycin in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 232
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
861amnon high in rural community bushbuckridge local municipality peri-urban community compared to city soweto urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 289
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
873amnon high in tanzania compared to botswana in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 333
847amnon high in ninth decade human stage compared to eleventh decade human stage centenarian human stage in feces japan 80 year-old and over human stage 2021-12-01v1No1 / 341
847amnon high in eleventh decade human stage centenarian human stage compared to ninth decade human stage in feces japan 80 year-old and over human stage 2021-12-01v1No1 / 387
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org