Summary for ontology term: human adult stage

Number of annotations with term: 205

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGCCCATCGCTTAACGGTGGGTCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.023923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.019139
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.019139
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGATGGCAAGTCAGATGTGAAATACCGGGGCTTAACCCCGGGGCTGCATTTGAAACTGTCGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.019139
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGGGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.019139
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.019139
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGAAAAGTCTGAAGTGAAAGGCAGTGGCTCAACCATTGTAGGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.019139
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.019139
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGATGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.019139
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.019139

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGAGGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.277778
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.277778
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTCAATTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.277778
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.277778
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.222222
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTACGGAGGATGCGAGCGTTATTCGGAATCATTGGGTTTAAAGGGTCTGTAGGCGGGCTATTAAGTCAGGGGTGAAAGGTTTCAGCTTAACTGAGAAATTGCCTTTGATACTGGTAGTCTTGAATATCTGTGAAGTTCTTGGAATGTGTAG0.222222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.222222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.222222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.222222

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.219570
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGATAGTGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.212766
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGATAATGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTA0.192708
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTGAGGCACGTGTGCCTTTTTGTATGTACCGTATGAATAAGGATCGGCTAACT0.189526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.184615
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGG0.176638
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTGGGGAATCTTGCGCAATGGGGGGAACCCTGACGCAGCGACGCCGCGTGCGGGACGGAGGCCTTCGGGTCGTAAACCGCTTTCAGCAGGGAAGAGTCAAGACTGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT0.172619
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGGATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.170543
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTGGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAAGGATGAAGTATTTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.162866
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGGGGAAGATAATGACGGTACCCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.162162

Annotations:

common ontology terms
term enrichment score
TermScore
human adult stage0.456090
adult0.331846
homo sapiens0.261729
fourth decade human stage0.206515
feces0.159075
human early adulthood stage0.157746
human late adulthood stage0.152635
female0.134563
japan0.133468
saliva0.131096
third decade human stage0.127854
fifth decade human stage0.108597
rural community0.105395
united states of america0.101410
kingdom of the netherlands0.094862
gestational diabetes0.085106
control0.082164
young adult stage0.081818
canada0.081159
pregnancy0.080537
ulcerative colitis0.073770
ninth decade human stage0.073733
china0.072762
guangzhou city prefecture0.071111
subgingival dental plaque0.069869
65-79 year-old human stage0.066038
state of new york0.062257
subgingival plaque0.060377
commonwealth of massachusetts0.059197
calgary0.056872
third trimester0.056075
LOWER IN iga negative fraction0.055607
iga positive fraction0.055607
LOWER IN iga positive fraction0.055607
iga negative fraction0.055607
LOWER IN fourth decade human stage0.055300
sixth decade human stage0.055300
nanning city prefecture0.055300
toronto0.053812
nanjing city prefecture0.052402
rectal swab0.051064
multiple sclerosis0.051064
amsterdam0.051064
tanzania0.051064
italy0.049645
south korea0.048583
LOWER IN 65-79 year-old human stage0.047619
state of texas0.047431
male0.047059
80 year-old and over human stage0.046512
caribbean latino0.046512
turin township0.046512
periodontal disease0.045283
LOWER IN control0.045198
LOWER IN ulcerative colitis0.044118
zhejiang province0.043321
intestinal mucosa0.042553
jiangsu province0.042403
periodontitis0.042403
australia0.041958
biopsy0.040816
commonwealth of pennsylvania0.039216
skin0.039088
rectum0.038462
tonsil surface0.038278
LOWER IN ninth decade human stage0.037915
urban community0.037915
LOWER IN fifth decade human stage0.037559
oslo0.037559
tenth decade human stage0.037559
age >940.037559
botswana0.037559
human middle aged stage0.036866
seoul0.036199
homosexual0.034934
msm0.034934
tonsil0.034335
kingdom of norway0.033755
austria0.033195
obesity0.031128
high bmi0.030651
africa0.030476
south africa0.030189
critical illness0.028846
intensive care unit admission0.028846
LOWER IN 25-44 year-old human stage0.028846
25-44 year-old human stage0.028846
spinal cord injury0.028436
centenarian human stage0.028436
eleventh decade human stage0.028436
non-pregnant0.028436
nephrolithiasis0.028436
peri-urban community0.028436
bushbuckridge local municipality0.028436
remission0.028037
cigarette smoking0.028037
before antibiotics0.028037
LOWER IN human late adulthood stage0.027650
non-smoker0.027650
systemic lupus erythematosus0.027650
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN critical illness1.000000
LOWER IN intensive care unit admission1.000000
calgary1.000000
LOWER IN day 71.000000
critical illness1.000000
intensive care unit admission1.000000
LOWER IN 25-44 year-old human stage1.000000
third decade human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
LOWER IN 65-79 year-old human stage1.000000
65-79 year-old human stage1.000000
25-44 year-old human stage1.000000
oral rinse1.000000
top of head1.000000
bangalore1.000000
tonsil surface1.000000
LOWER IN mouthwash1.000000
mouthwash1.000000
no dental caries1.000000
fourth decade human stage0.875000
fifth decade human stage0.750000
LOWER IN ninth decade human stage0.666667
ninth decade human stage0.666667
third trimester0.666667
LOWER IN urban community0.666667
urban community0.666667
young adult stage0.600000
human late adulthood stage0.583333
LOWER IN iga negative fraction0.555556
iga positive fraction0.555556
LOWER IN iga positive fraction0.555556
iga negative fraction0.555556
day 10.500000
LOWER IN fifth decade human stage0.500000
LOWER IN fourth decade human stage0.500000
spinal cord injury0.500000
17-29-years-old human0.500000
oslo0.500000
20-year-old human stage0.500000
oesophageal brush0.500000
LOWER IN tenth decade human stage0.500000
LOWER IN age >940.500000
soldiers0.500000
tenth decade human stage0.500000
age >940.500000
LOWER IN soldiers0.500000
LOWER IN spinal cord injury0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
non-celiac gluten sensitivity0.500000
stimulated saliva0.500000
80 year-old and over human stage0.500000
centenarian human stage0.500000
eleventh decade human stage0.500000
LOWER IN eleventh decade human stage0.500000
LOWER IN centenarian human stage0.500000
LOWER IN 80 year-old and over human stage0.500000
skin of forehead0.500000
non-pregnant0.500000
LOWER IN non-pregnant0.500000
caribbean latino0.500000
sixth decade human stage0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
nephrolithiasis0.500000
kuwait0.500000
LOWER IN soweto0.500000
peri-urban community0.500000
bushbuckridge local municipality0.500000
LOWER IN bushbuckridge local municipality0.500000
LOWER IN peri-urban community0.500000
soweto0.500000
turin township0.500000
LOWER IN second trimester0.500000
second trimester0.500000
after roux-en-y gastric bypass surgery0.500000
LOWER IN before roux-en-y gastric bypass surgery0.500000
LOWER IN after roux-en-y gastric bypass surgery0.500000
before roux-en-y gastric bypass surgery0.500000
auckland city0.500000
LOWER IN botswana0.500000
botswana0.500000
LOWER IN burunge0.500000
LOWER IN sandawe0.500000
LOWER IN maasai0.500000
burunge0.500000
sandawe0.500000
maasai0.500000
buffalo0.500000
postmenopausal0.500000
saen thong subdistrict0.500000
LOWER IN high breath methane content0.500000
low breath methane content0.500000
LOWER IN low breath methane content0.500000
high breath methane content0.500000
human adult stage0.486486
human early adulthood stage0.411765
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.931707
adult0.795122
feces0.692683
human adult stage0.429268
united states of america0.282927
china0.229268
female0.151220
control0.141463
fourth decade human stage0.117073
saliva0.117073
japan0.107317
human early adulthood stage0.097561
human late adulthood stage0.087805
canada0.068293
third decade human stage0.068293
rural community0.068293
fifth decade human stage0.058537
kingdom of the netherlands0.058537
LOWER IN control0.048780
pregnancy0.048780
male0.048780
gestational diabetes0.048780
ulcerative colitis0.043902
young adult stage0.043902
guangzhou city prefecture0.039024
ninth decade human stage0.039024
subgingival dental plaque0.039024
subgingival plaque0.039024
state of new york0.039024
africa0.039024
65-79 year-old human stage0.034146
italy0.034146
commonwealth of massachusetts0.034146
nanjing city prefecture0.029268
calgary0.029268
rectal swab0.029268
LOWER IN fourth decade human stage0.029268
south korea0.029268
toronto0.029268
LOWER IN iga negative fraction0.029268
iga positive fraction0.029268
state of texas0.029268
LOWER IN iga positive fraction0.029268
iga negative fraction0.029268
australia0.029268
jiangsu province0.029268
zhejiang province0.029268
multiple sclerosis0.029268
skin0.029268
third trimester0.029268
sixth decade human stage0.029268
nanning city prefecture0.029268
periodontal disease0.029268
periodontitis0.029268
amsterdam0.029268
tanzania0.029268
LOWER IN ulcerative colitis0.024390
LOWER IN 65-79 year-old human stage0.024390
80 year-old and over human stage0.024390
caribbean latino0.024390
rectum0.024390
intestinal mucosa0.024390
biopsy0.024390
turin township0.024390
commonwealth of pennsylvania0.024390
LOWER IN fifth decade human stage0.019512
kingdom of norway0.019512
oslo0.019512
LOWER IN adult0.019512
LOWER IN ninth decade human stage0.019512
tenth decade human stage0.019512
age >940.019512
seoul0.019512
tonsil surface0.019512
tonsil0.019512
homosexual0.019512
msm0.019512
human middle aged stage0.019512
south africa0.019512
urban community0.019512
high bmi0.019512
obesity0.019512
botswana0.019512
austria0.019512
disease0.014634
critical illness0.014634
intensive care unit admission0.014634
LOWER IN human late adulthood stage0.014634
parkinson's disease0.014634
remission0.014634
LOWER IN 25-44 year-old human stage0.014634
spinal cord injury0.014634
child0.014634
LOWER IN child0.014634
city0.014634
25-44 year-old human stage0.014634
centenarian human stage0.014634
eleventh decade human stage0.014634
non-pregnant0.014634
nephrolithiasis0.014634
Number of experiments associating the term to the sequence
TermScore
homo sapiens44.000000
adult39.000000
feces31.000000
human adult stage18.000000
united states of america16.000000
control11.000000
china8.000000
LOWER IN control8.000000
female8.000000
human late adulthood stage7.000000
fourth decade human stage7.000000
human early adulthood stage7.000000
saliva7.000000
third decade human stage5.000000
LOWER IN iga negative fraction5.000000
iga positive fraction5.000000
LOWER IN iga positive fraction5.000000
iga negative fraction5.000000
LOWER IN fourth decade human stage4.000000
canada3.000000
fifth decade human stage3.000000
LOWER IN human late adulthood stage3.000000
ulcerative colitis3.000000
japan3.000000
LOWER IN ulcerative colitis3.000000
LOWER IN 25-44 year-old human stage3.000000
child3.000000
LOWER IN child3.000000
pregnancy3.000000
LOWER IN adult3.000000
LOWER IN 65-79 year-old human stage3.000000
65-79 year-old human stage3.000000
young adult stage3.000000
25-44 year-old human stage3.000000
rural community3.000000
LOWER IN fifth decade human stage2.000000
south korea2.000000
4-year-old human stage2.000000
LOWER IN 4-year-old human stage2.000000
guangzhou city prefecture2.000000
city2.000000
australia2.000000
LOWER IN ninth decade human stage2.000000
ninth decade human stage2.000000
italy2.000000
commonwealth of massachusetts2.000000
skin2.000000
third trimester2.000000
male2.000000
LOWER IN urban community2.000000
urban community2.000000
subgingival dental plaque2.000000
subgingival plaque2.000000
state of new york2.000000
kingdom of the netherlands2.000000
nanjing city prefecture1.000000
LOWER IN critical illness1.000000
LOWER IN intensive care unit admission1.000000
calgary1.000000
rectal swab1.000000
LOWER IN day 71.000000
day 11.000000
disease1.000000
critical illness1.000000
intensive care unit admission1.000000
parkinson's disease1.000000
remission1.000000
spinal cord injury1.000000
toronto1.000000
17-29-years-old human1.000000
kingdom of norway1.000000
oslo1.000000
state of texas1.000000
20-year-old human stage1.000000
oesophageal brush1.000000
LOWER IN tenth decade human stage1.000000
LOWER IN age >941.000000
soldiers1.000000
tenth decade human stage1.000000
age >941.000000
LOWER IN soldiers1.000000
LOWER IN spinal cord injury1.000000
age 3-61.000000
age 8-121.000000
LOWER IN age 3-61.000000
LOWER IN age 8-121.000000
jiangsu province1.000000
non-celiac gluten sensitivity1.000000
stimulated saliva1.000000
80 year-old and over human stage1.000000
centenarian human stage1.000000
eleventh decade human stage1.000000
LOWER IN eleventh decade human stage1.000000
LOWER IN centenarian human stage1.000000
LOWER IN 80 year-old and over human stage1.000000
zhejiang province1.000000
multiple sclerosis1.000000
seoul1.000000
skin of forehead1.000000
non-pregnant1.000000
LOWER IN non-pregnant1.000000
caribbean latino1.000000
oral rinse1.000000
top of head1.000000
bangalore1.000000
tonsil surface1.000000
tonsil1.000000
homosexual1.000000
msm1.000000
LOWER IN mouthwash1.000000
mouthwash1.000000
sixth decade human stage1.000000
nanning city prefecture1.000000
LOWER IN nephrolithiasis1.000000
nephrolithiasis1.000000
rectum1.000000
intestinal mucosa1.000000
biopsy1.000000
no dental caries1.000000
kuwait1.000000
LOWER IN soweto1.000000
peri-urban community1.000000
bushbuckridge local municipality1.000000
human middle aged stage1.000000
south africa1.000000
LOWER IN bushbuckridge local municipality1.000000
LOWER IN peri-urban community1.000000
soweto1.000000
periodontal disease1.000000
periodontitis1.000000
cigarette smoking1.000000
non-smoker1.000000
gestational diabetes1.000000
turin township1.000000
LOWER IN second trimester1.000000
second trimester1.000000
high bmi1.000000
obesity1.000000
after roux-en-y gastric bypass surgery1.000000
LOWER IN before roux-en-y gastric bypass surgery1.000000
LOWER IN after roux-en-y gastric bypass surgery1.000000
before roux-en-y gastric bypass surgery1.000000
auckland city1.000000
before antibiotics1.000000
amsterdam1.000000
LOWER IN botswana1.000000
commonwealth of pennsylvania1.000000
tanzania1.000000
botswana1.000000
africa1.000000
LOWER IN burunge1.000000
LOWER IN sandawe1.000000
LOWER IN maasai1.000000
burunge1.000000
sandawe1.000000
maasai1.000000
buffalo1.000000
postmenopausal1.000000
saen thong subdistrict1.000000
systemic lupus erythematosus1.000000
LOWER IN high breath methane content1.000000
low breath methane content1.000000
austria1.000000
LOWER IN low breath methane content1.000000
high breath methane content1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
131amnonpositively correlated with age (30-80 years) ( high in human late adulthood stage age compared to fifth decade human stage fourth decade human stage in homo sapiens feces south korea )2017-04-16v41 / 1approvedNo
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v31 / 2approvedNo
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 2approvedNo
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v31 / 2approvedNo
877amnon high in low breath methane content compared to high breath methane content in human early adulthood stage adult homo sapiens feces austria 2022-03-08v41 / 2approvedNo
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v41 / 3approvedNo
988amnon high in control compared to mouthwash in male tonsil surface tonsil young adult stage homosexual msm australia homo sapiens 2022-12-26v41 / 3approvedNo
976amnoncommon human early adulthood stage, vagina, first trimester, pregnancy, female, guangzhou city prefecture, china2022-12-24v31 / 4approvedNo
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v41 / 4approvedNo
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 5approvedNo
976amnondominant china, guangzhou city prefecture, female, pregnancy, first trimester, vagina, human early adulthood stage2022-12-24v31 / 6approvedNo
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v31 / 6approvedNo
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v41 / 6approvedNo
841amnon high in iga negative fraction compared to iga positive fraction in human adult stage state of texas adult saliva united states of america homo sapiens 2021-11-08v41 / 7approvedNo
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v31 / 7approvedNo
1017amnon high in day 1 compared to day 7 in disease critical illness intensive care unit admission homo sapiens rectal swab adult human adult stage canada calgary 2023-04-02v41 / 8approvedNo
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v41 / 8approvedNo
847amnon high in 25-44 year-old human stage compared to 80 year-old and over human stage ninth decade human stage in japan feces 2021-12-01v11 / 9approvedNo
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 9approvedNo
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in japan feces 2021-12-01v11 / 10approvedNo
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v41 / 10approvedNo
999amnondominant homo sapiens, skin, india, female, adult, human early adulthood stage, bangalore, top of head2022-12-31v31 / 10approvedNo
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v31 / 11approvedNo
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v31 / 11approvedNo
847amnondominant 80 year-old and over human stage, ninth decade human stage, japan, feces2021-12-01v11 / 12approvedNo
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v31 / 12approvedNo
873amnondominant urban community, human adult stage, commonwealth of pennsylvania, adult, united states of america, homo sapiens, feces2022-03-03v11 / 12approvedNo
1020amnon high in remission ulcerative colitis compared to control in human adult stage adult japan feces homo sapiens 2023-04-06v31 / 13approvedNo
847amnondominant centenarian human stage, eleventh decade human stage, japan, feces2021-12-01v11 / 13approvedNo
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v31 / 13approvedNo
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 13approvedNo
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v41 / 13approvedNo
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v41 / 14approvedNo
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 14approvedNo
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v11 / 14approvedNo
846amnondominant stimulated saliva, human adult stage, commonwealth of massachusetts, adult, saliva, united states of america, homo sapiens2021-11-20v31 / 15approvedNo
847amnondominant human early adulthood stage, japan, feces2021-12-01v11 / 15approvedNo
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 15approvedNo
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v31 / 15approvedNo
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v41 / 16approvedNo
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v41 / 17approvedNo
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v31 / 17approvedNo
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 17approvedNo
885amnondominant human early adulthood stage, state of florida, united states of america, homo sapiens, feces2022-03-26v31 / 18approvedNo
892amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-04-07v41 / 18approvedNo
841amnondominant human adult stage, state of texas, adult, saliva, united states of america, homo sapiens2021-11-08v41 / 18approvedNo
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v41 / 18approvedNo
922amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-07-25v41 / 18approvedNo
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v31 / 18approvedNo
875amnondominant human late adulthood stage, saen thong subdistrict, village, rural community, thailand, adult, homo sapiens, feces2022-03-04v31 / 18approvedNo
880amnondominant human adult stage, kingdom of denmark, adult, homo sapiens, feces2022-03-12v31 / 18approvedNo
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 19approvedNo
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v41 / 19approvedNo
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 19approvedNo
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 19approvedNo
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 19approvedNo
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 19approvedNo
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 19approvedNo
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v31 / 19approvedNo
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v41 / 20approvedNo
1020amnondominant homo sapiens, feces, japan, adult, human adult stage, ulcerative colitis, remission2023-04-06v31 / 20approvedNo
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v41 / 20approvedNo
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 20approvedNo
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v41 / 20approvedNo
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 20approvedNo
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v31 / 20approvedNo
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v41 / 21approvedNo
1020amnondominant homo sapiens, feces, japan, adult, human adult stage, control2023-04-06v31 / 21approvedNo
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v41 / 21approvedNo
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v41 / 21approvedNo
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v31 / 21approvedNo
988amnondominant homo sapiens, australia, msm, homosexual, young adult stage, tonsil, tonsil surface, male2022-12-26v41 / 21approvedNo
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v31 / 21approvedNo
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v31 / 21approvedNo
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v31 / 21approvedNo
870amnondominant fourth decade human stage, third decade human stage, auckland city, new zealand, adult, homo sapiens, feces2022-02-18v31 / 21approvedNo
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v41 / 21approvedNo
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v41 / 21approvedNo
1017amnondominant disease, critical illness, intensive care unit admission, homo sapiens, rectal swab, adult, human adult stage, canada, calgary2023-04-02v41 / 22approvedNo
1017amnondominant homo sapiens, rectal swab, adult, human adult stage, canada, calgary, control2023-04-02v41 / 22approvedNo
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v41 / 22approvedNo
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v31 / 22approvedNo
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 22approvedNo
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v41 / 22approvedNo
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 22approvedNo
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v41 / 23approvedNo
843amnondominant non-celiac gluten sensitivity, human adult stage, italy, adult, feces2021-11-17v31 / 23approvedNo
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v31 / 23approvedNo
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in adult midwest region united states of america feces homo sapiens 2021-02-25v31 / 24approvedNo
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v31 / 24approvedNo
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 25approvedNo
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v31 / 25approvedNo
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 25approvedNo
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 26approvedNo
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 26approvedNo
999amnoncommon top of head, bangalore, human early adulthood stage, adult, female, india, skin, homo sapiens2022-12-31v31 / 27approvedNo
841amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america state of texas saliva homo sapiens 2021-11-08v41 / 28approvedNo
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v41 / 30approvedNo
988amnon high in mouthwash compared to control in homo sapiens australia msm homosexual young adult stage tonsil tonsil surface male 2022-12-26v41 / 30approvedNo
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 30approvedNo
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 30approvedNo
1020amnoncommon remission, ulcerative colitis, human adult stage, adult, japan, feces, homo sapiens2023-04-06v31 / 31approvedNo
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in adult midwest region united states of america feces homo sapiens 2021-02-25v31 / 32approvedNo
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v31 / 33approvedNo
1017amnon high in control compared to critical illness disease intensive care unit admission in calgary canada human adult stage adult rectal swab homo sapiens 2023-04-02v41 / 35approvedNo
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 35approvedNo
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v41 / 36approvedNo
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v41 / 36approvedNo
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v11 / 37approvedNo
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 38approvedNo
131amnonnegatively correlated with age (30-80 years) ( high in fifth decade human stage fourth decade human stage age compared to human late adulthood stage in homo sapiens feces south korea )2017-04-16v41 / 39approvedNo
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 40approvedNo
1017amnoncommon calgary, canada, human adult stage, adult, rectal swab, homo sapiens, intensive care unit admission, critical illness, disease2023-04-02v41 / 44approvedNo
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v31 / 44approvedNo
985amnon high in third decade human stage compared to human late adulthood stage in oral rinse saliva adult hong kong homo sapiens 2022-12-26v11 / 45approvedNo
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v31 / 45approvedNo
1020amnoncommon control, human adult stage, adult, japan, feces, homo sapiens2023-04-06v31 / 46approvedNo
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v11 / 46approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v41 / 47approvedNo
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v31 / 48approvedNo
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v31 / 48approvedNo
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v31 / 50approvedNo
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 51approvedNo
847amnoncommon ninth decade human stage, 80 year-old and over human stage, japan, feces2021-12-01v11 / 52approvedNo
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 52approvedNo
847amnoncommon eleventh decade human stage, centenarian human stage, japan, feces2021-12-01v11 / 54approvedNo
847amnoncommon human early adulthood stage, japan, feces2021-12-01v11 / 54approvedNo
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v41 / 54approvedNo
653amnon high in saliva compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 55approvedNo
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 55approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v41 / 56approvedNo
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v41 / 56approvedNo
985amnon high in human late adulthood stage compared to third decade human stage in homo sapiens hong kong adult saliva oral rinse 2022-12-26v11 / 56approvedNo
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v31 / 56approvedNo
866amnon high in iga negative fraction compared to iga positive fraction in human adult stage adult homo sapiens united states of america feces 2022-02-08v41 / 58approvedNo
877amnon high in high breath methane content compared to low breath methane content in human early adulthood stage austria adult homo sapiens feces 2022-03-08v41 / 58approvedNo
843amnoncommon non-celiac gluten sensitivity, italy, feces, human adult stage, adult2021-11-17v31 / 59approvedNo
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v31 / 61approvedNo
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v31 / 63approvedNo
945amnon high in 65-79 year-old human stage compared to 25-44 year-old human stage in homo sapiens oral cavity oral wash adult united states of america 2022-11-29v41 / 63approvedNo
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 64approvedNo
875amnoncommon saen thong subdistrict, village, rural community, thailand, adult, human late adulthood stage, feces, homo sapiens2022-03-04v31 / 65approvedNo
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v31 / 67approvedNo
846amnoncommon commonwealth of massachusetts, united states of america, human adult stage, adult, stimulated saliva, saliva, homo sapiens2021-11-20v31 / 69approvedNo
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 70approvedNo
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v31 / 71approvedNo
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 72approvedNo
1020amnon high in control compared to remission ulcerative colitis in homo sapiens feces japan adult human adult stage 2023-04-06v31 / 73approvedNo
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v11 / 73approvedNo
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v41 / 76approvedNo
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 77approvedNo
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v31 / 79approvedNo
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 81approvedNo
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 81approvedNo
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 82approvedNo
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v41 / 83approvedNo
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 85approvedNo
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v41 / 86approvedNo
892amnoncommon saliva, united states of america, human adult stage, adult, homo sapiens2022-04-07v41 / 87approvedNo
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v41 / 87approvedNo
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v41 / 88approvedNo
922amnoncommon human adult stage, united states of america, saliva, adult, homo sapiens2022-07-25v41 / 88approvedNo
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 89approvedNo
988amnoncommon male, tonsil surface, tonsil, young adult stage, homosexual, msm, australia, homo sapiens2022-12-26v41 / 89approvedNo
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 92approvedNo
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 93approvedNo
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 97approvedNo
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v41 / 101approvedNo
1017amnoncommon control, calgary, canada, human adult stage, adult, rectal swab, homo sapiens2023-04-02v41 / 101approvedNo
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v41 / 102approvedNo
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 104approvedNo
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 111approvedNo
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v11 / 112approvedNo
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v31 / 113approvedNo
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 115approvedNo
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v41 / 121approvedNo
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 125approvedNo
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v41 / 129approvedNo
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v41 / 130approvedNo
945amnon high in 25-44 year-old human stage compared to 65-79 year-old human stage in united states of america adult oral wash oral cavity homo sapiens 2022-11-29v41 / 142approvedNo
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 145approvedNo
885amnoncommon human early adulthood stage, state of florida, united states of america, feces, homo sapiens2022-03-26v31 / 152approvedNo
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in third decade human stage toronto canada adult homo sapiens 2020-09-13v31 / 157approvedNo
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v41 / 180approvedNo
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v31 / 185approvedNo
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v41 / 203approvedNo
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 205approvedNo
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v11 / 226approvedNo
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v11 / 227approvedNo
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v31 / 232approvedNo
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v41 / 238approvedNo
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v41 / 239approvedNo
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 275approvedNo
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v41 / 279approvedNo
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v41 / 281approvedNo
861amnon high in peri-urban community rural community bushbuckridge local municipality compared to city urban community soweto in human middle aged stage female south africa feces homo sapiens 2022-01-15v31 / 289approvedNo
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in third decade human stage toronto canada adult homo sapiens 2020-09-13v31 / 291approvedNo
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 291approvedNo
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v31 / 306approvedNo
873amnon high in tanzania compared to botswana in human adult stage rural community africa adult homo sapiens feces 2022-03-03v11 / 333approvedNo
847amnon high in ninth decade human stage compared to eleventh decade human stage centenarian human stage in 80 year-old and over human stage japan feces 2021-12-01v11 / 341approvedNo
847amnon high in centenarian human stage eleventh decade human stage compared to ninth decade human stage in 80 year-old and over human stage feces japan 2021-12-01v11 / 387approvedNo
438amnonhigher in centenarians compared to adults ( high in tenth decade human stage ninth decade human stage age >94 compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage in homo sapiens feces china )2018-12-30v41 / 474approvedNo
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v41 / 486approvedNo
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage age >94 compared to young adult stage soldiers in homo sapiens feces china )2018-12-30v41 / 617approvedNo

Problems / suggestions? Please email info AT dbbact DOT org