Summary for ontology term: hunter gatherer

Number of annotations with term: 30

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTCAATTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.107143
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTATTTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGGATAACTAGAGTAGGTGAGAGGGGAGTAGAATTCCAGG0.107143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.107143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.107143
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAACTCCGCA0.071429
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.071429
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.071429
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.071429
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTGAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.071429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGATAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTGAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.071429

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGAGGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTTTTCAAGTCAGGGGTGAAAACTTATGGCTCAACCATAAGCTTGCCTTTGAAACTGAAAAACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCAGTCTTGAGTACAGTTGAGGTAGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTTACAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGTTAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTGACAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGACAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTTGTTCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGCGCACGTAGGTGGTTCGACAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGATGTGCATTTGAAACTGTTGGACTCGAGTACTGTAGAGGGAGGTAGAATTCCAGG0.246154
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTCGTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAGGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.243902
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGCGTAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTATGTAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCCAG0.235294
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAACTCCGCA0.222222
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCTAGGAGCTTAACTTCTAAACTGCTTGGGAAACTGATAATCTAGAGTGGGGGAGAGGCAGATGGAATTGGTGG0.222222
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.205128
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTTTTCAAGTCAGGGGTGAAAACTTATGGCTCAACTATAAGCTTGCCTTTGAAACTGAAAGACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.203390
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__KocuriaTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTTGAGTGCAGTAGGGGAGACTGGAACTCCTGG0.196078
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTGAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.192308
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATTGCAAGTCAGGTGTGAAAATTATGGGCTCAACCCATAAACTGCACTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAACGGAATTCCTAG0.190476

Annotations:

common ontology terms
term enrichment score
TermScore
hunter gatherer0.928571
venezuela0.649573
amerindian0.649573
hadza0.378378
tanzania0.347826
LOWER IN hunter gatherer0.210526
LOWER IN venezuela0.153846
LOWER IN amerindian0.153846
arm0.111111
skin0.093023
commonwealth of pennsylvania0.083333
LOWER IN obsolete_juvenile stage0.080000
obsolete_juvenile stage0.080000
rural community0.076923
saliva0.074766
LOWER IN city0.066667
city0.066667
LOWER IN hadza0.062500
camp hukamako0.062500
LOWER IN camp sengeli0.062500
camp sengeli0.062500
LOWER IN camp hukamako0.062500
dry season0.055556
LOWER IN wet season0.055556
wet season0.055556
LOWER IN dry season0.055556
human adult stage0.054054
LOWER IN infant0.048780
infant0.048780
africa0.037736
homo sapiens0.029091
feces0.024883
adult0.021277
LOWER IN adult0.010638
LOWER IN united states of america0.007782
united states of america0.007782
LOWER IN maasai0.000000
LOWER IN sandawe0.000000
LOWER IN burunge0.000000
maasai0.000000
sandawe0.000000
burunge0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer1.000000
hadza1.000000
venezuela0.666667
amerindian0.666667
LOWER IN hunter gatherer0.500000
tanzania0.500000
LOWER IN hadza0.500000
camp hukamako0.500000
LOWER IN camp sengeli0.500000
camp sengeli0.500000
LOWER IN camp hukamako0.500000
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
arm0.333333
dry season0.166667
LOWER IN wet season0.166667
wet season0.166667
LOWER IN dry season0.166667
commonwealth of pennsylvania0.111111
LOWER IN obsolete_juvenile stage0.100000
obsolete_juvenile stage0.100000
rural community0.090909
skin0.060606
LOWER IN city0.050000
city0.050000
human adult stage0.045455
saliva0.043478
LOWER IN infant0.038462
infant0.038462
africa0.026316
homo sapiens0.014760
feces0.012739
adult0.011561
LOWER IN adult0.005780
LOWER IN united states of america0.004049
united states of america0.004049
LOWER IN maasai0.000000
LOWER IN sandawe0.000000
LOWER IN burunge0.000000
maasai0.000000
sandawe0.000000
burunge0.000000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
hunter gatherer0.866667
venezuela0.633333
amerindian0.633333
feces0.533333
saliva0.266667
tanzania0.266667
hadza0.233333
skin0.200000
LOWER IN hunter gatherer0.133333
adult0.133333
LOWER IN united states of america0.100000
LOWER IN city0.100000
united states of america0.100000
city0.100000
LOWER IN venezuela0.100000
LOWER IN amerindian0.100000
LOWER IN infant0.066667
LOWER IN obsolete_juvenile stage0.066667
infant0.066667
obsolete_juvenile stage0.066667
LOWER IN adult0.066667
africa0.066667
commonwealth of pennsylvania0.066667
rural community0.066667
human adult stage0.066667
arm0.066667
LOWER IN maasai0.033333
LOWER IN sandawe0.033333
LOWER IN burunge0.033333
maasai0.033333
sandawe0.033333
burunge0.033333
LOWER IN hadza0.033333
camp hukamako0.033333
LOWER IN camp sengeli0.033333
camp sengeli0.033333
LOWER IN camp hukamako0.033333
dry season0.033333
LOWER IN wet season0.033333
wet season0.033333
LOWER IN dry season0.033333
Exp. ID User ID Description Date Region Flag Sequences
371amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 11
75amnondominant homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
190amnondominant feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
75amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
371amnonnegatively correlated with age in amerindian saliva ( high in infant obsolete_juvenile stage compared to adult in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 16
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to infant obsolete_juvenile stage in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 17
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in feces homo sapiens tanzania hunter gatherer hadza )2017-09-04v4No1 / 20
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
371amnonhigher in saliva of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens saliva )2018-09-06v4No1 / 24
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 27
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in feces homo sapiens tanzania hunter gatherer hadza )2017-09-04v4No1 / 35
873amnon high in hunter gatherer hadza compared to maasai sandawe burunge in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 37
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
873amnon high in maasai sandawe burunge compared to hunter gatherer hadza in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 46
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854

Problems / suggestions? Please email info AT dbbact DOT org