Summary for ontology term: ice

Number of annotations with term: 51

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGATGACAGCCTGTGGGTCGTAAACTCCTTTTCTCAGAGAAGAAGTTCTGACGGTATCTGAGGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGG0.625000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATACCGCGTGAGGGACGACGGCTTTTGGGTTGTAAACCTCTTTTCCCTGGGAAGAAGATCTGACGGTACCAGGGGAATCAGCATCGGCTAACTTCGTGCCAGCAGCCGCGG0.625000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCTGCAATGGGCGAAAGCCTGACAGAGCAATACCGCGTGAGGGATGAAGGCCTACGGGTTGTAAACCTCTTTTCTCAAGGAGGAAGATCTGACGTTACTTGAGGAATAAGCATCGGCTAACCCTGTGCCAGCAGCCGCGG0.588235
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTAGGGAATATTGGGCAATGGAGGAGACTCTGACCCAGCCATGCCGCGTGCCGGATGAAGGCCTTCTGGGTCGTAAACGGCTTTTTTCCGGGAAGAACCGGTTCTGTGCGCAGGGCTTTGACGGTACCGGGAGAATAAGCACCGGCTAACT0.533333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAGGGACGACGGCCTTCGGGTTGTAAACCTCTTTTAGTAGGGAAGAAGCGTAAAAGTGACGGTACCTGCAGAAAAAGCACCGGCTAACTACGTGCCAGCAGC0.533333
d__Bacteria;p__candidate division WPS-2;g__WPS-2_genera_incertae_sedisTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCGACGCCGCGTGTGGGAAGAAGGCCTTCGGGTCGTAAACCACTGTCGAAGGGGACTATAATGAATGTACCCTTGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.533333
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTGGGGAATTTTCCGCAATGGGCGCAAGCCTGACGGAGCAATACCGCGTGAGGGAGGAAGGCTCTTGGGTCGTAAACCTCTTTTATCAGGGAAGAACACAATGACGGTACCTGATGAATCAGCATCGGCTAACTCTGTGCCAGCAGCCGCG0.533333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTGGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTCTTTTGGGACGATAATGACGGTACCAAAGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.533333
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__FerruginibacterTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGCAGGATGACGGCCCTCTGGGTTGTAAACTGCTTTTATAGGGGACGAAAAAAGGGCTTTCTAGCTCGTCTGACGGTACCCTAGGAATAAGCACCGGCTAACT0.533333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Pseudonocardiaceae;g__PseudonocardiaTGGGGAATATTGCGCAATGGGCGGAAGCCTGACGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGACCTTGACGAAGCCTTCGGGTGACGGTAGGGGTAGAAGAAGCACCGGCCAACTACGTGCCAGCAGC0.533333

Annotations:

common ontology terms
term enrichment score
TermScore
rock0.426966
depth 0-20cm0.408163
limestone0.320000
fungicide0.320000
tobacco field0.320000
difenoconazole0.320000
ice0.279070
glacier0.244898
quarry0.238806
hydrothermal vent0.190476
volcanic crater0.190476
volcanic rock0.190476
marine hydrothermal vent0.190476
greece0.190476
calvert island0.190476
province of british columbia0.160000
biofilm0.149533
state of minnesota0.139130
mediterranean sea0.137931
filtered 0.2um0.137931
duluth complex0.135593
greenschist0.135593
without plants0.135593
tobacco plant present0.135593
sulfide0.126984
ph 70.112676
biochar0.109890
active vent0.105263
inactive vent0.105263
epilithic0.105263
low tide zone0.105263
high tide zone0.105263
subsurface0.105263
depth 20-100cm0.105263
surface0.090909
sweden0.089744
ph 7-80.086022
ocean0.081633
river0.080808
marine sediment0.078431
ph 4-50.077670
respirable suspended particulate matter0.075472
depth 2.5cm0.072727
LOWER IN depth 2.5cm0.072727
sandstone0.072727
grand staircase-escalante national park0.072727
depth (soil) 0-1cm0.072727
glacial ice0.072727
shetland islands0.072727
south shetland glacier0.072727
minas gerais state0.072727
campos rupestres0.072727
LOWER IN depth0.070175
depth0.070175
state of utah0.070175
municipality of beijing0.070175
LOWER IN depth (soil) 15cm0.067797
depth (soil) 15cm0.067797
pacific ocean0.059701
canada0.059701
desert0.059701
kingdom of spain0.059259
air0.053333
sea water0.045977
brazil0.044944
city0.043956
LOWER IN active vent0.037736
LOWER IN inactive vent0.037736
sand0.037736
epipsammic0.037736
LOWER IN epilithic0.037736
LOWER IN sand0.037736
LOWER IN epipsammic0.037736
LOWER IN high tide zone0.037736
LOWER IN low tide zone0.037736
LOWER IN subsurface0.037736
LOWER IN depth 20-100cm0.037736
absence of tobacco plants0.037736
LOWER IN presence of tobacco plants0.037736
presence of tobacco plants0.037736
LOWER IN absence of tobacco plants0.037736
LOWER IN depth 0-20cm0.037037
LOWER IN surface0.035714
sediment0.034783
LOWER IN rock0.033898
water0.031496
china0.022311
soil0.019370
united states of america0.015552
pm100.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
respirable suspended particulate matter1.000000
ice0.666667
depth 0-20cm0.666667
depth 2.5cm0.500000
quarry0.500000
rock0.500000
duluth complex0.500000
greenschist0.500000
LOWER IN depth 2.5cm0.500000
hydrothermal vent0.500000
volcanic crater0.500000
volcanic rock0.500000
marine hydrothermal vent0.500000
greece0.500000
active vent0.500000
inactive vent0.500000
LOWER IN active vent0.500000
LOWER IN inactive vent0.500000
sandstone0.500000
grand staircase-escalante national park0.500000
depth (soil) 0-1cm0.500000
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
sand0.500000
epipsammic0.500000
LOWER IN epilithic0.500000
epilithic0.500000
LOWER IN sand0.500000
LOWER IN epipsammic0.500000
low tide zone0.500000
LOWER IN high tide zone0.500000
calvert island0.500000
high tide zone0.500000
LOWER IN low tide zone0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
limestone0.500000
fungicide0.500000
tobacco field0.500000
difenoconazole0.500000
without plants0.500000
minas gerais state0.500000
campos rupestres0.500000
tobacco plant present0.500000
absence of tobacco plants0.500000
LOWER IN presence of tobacco plants0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
glacier0.400000
LOWER IN depth0.333333
sulfide0.333333
depth0.333333
state of utah0.333333
LOWER IN depth 0-20cm0.333333
municipality of beijing0.333333
LOWER IN depth (soil) 15cm0.250000
depth (soil) 15cm0.250000
province of british columbia0.250000
ph 70.200000
surface0.200000
LOWER IN surface0.200000
mediterranean sea0.166667
filtered 0.2um0.166667
biofilm0.142857
state of minnesota0.125000
desert0.125000
LOWER IN rock0.125000
biochar0.125000
river0.083333
air0.083333
ph 4-50.076923
sweden0.066667
ocean0.062500
marine sediment0.058824
ph 7-80.052632
brazil0.052632
city0.050000
kingdom of spain0.047619
pacific ocean0.040000
canada0.040000
sediment0.031250
sea water0.028571
water0.018182
china0.011628
soil0.010101
united states of america0.008097
pm100.000000
Fraction of annotations for the query sequences containing the term
TermScore
rock0.372549
depth 0-20cm0.294118
china0.274510
soil0.235294
ph 7-80.235294
limestone0.235294
fungicide0.235294
tobacco field0.235294
difenoconazole0.235294
united states of america0.196078
glacier0.176471
ice0.176471
quarry0.156863
state of minnesota0.156863
biofilm0.156863
sweden0.137255
hydrothermal vent0.117647
volcanic crater0.117647
water0.117647
volcanic rock0.117647
marine sediment0.117647
sea water0.117647
marine hydrothermal vent0.117647
mediterranean sea0.117647
greece0.117647
ocean0.117647
pacific ocean0.117647
canada0.117647
province of british columbia0.117647
calvert island0.117647
filtered 0.2um0.117647
biochar0.098039
sulfide0.078431
duluth complex0.078431
ph 4-50.078431
ph 70.078431
greenschist0.078431
river0.078431
kingdom of spain0.078431
without plants0.078431
tobacco plant present0.078431
active vent0.058824
inactive vent0.058824
epilithic0.058824
low tide zone0.058824
high tide zone0.058824
surface0.058824
subsurface0.058824
depth 20-100cm0.058824
depth 2.5cm0.039216
LOWER IN depth0.039216
LOWER IN depth (soil) 15cm0.039216
depth0.039216
depth (soil) 15cm0.039216
LOWER IN depth 2.5cm0.039216
desert0.039216
sandstone0.039216
state of utah0.039216
grand staircase-escalante national park0.039216
depth (soil) 0-1cm0.039216
glacial ice0.039216
shetland islands0.039216
south shetland glacier0.039216
sediment0.039216
brazil0.039216
minas gerais state0.039216
campos rupestres0.039216
city0.039216
air0.039216
respirable suspended particulate matter0.039216
municipality of beijing0.039216
pm100.039216
LOWER IN active vent0.019608
LOWER IN inactive vent0.019608
sand0.019608
epipsammic0.019608
LOWER IN rock0.019608
LOWER IN epilithic0.019608
LOWER IN sand0.019608
LOWER IN epipsammic0.019608
LOWER IN high tide zone0.019608
LOWER IN low tide zone0.019608
LOWER IN subsurface0.019608
LOWER IN depth 20-100cm0.019608
LOWER IN surface0.019608
LOWER IN depth 0-20cm0.019608
contamination0.019608
absence of tobacco plants0.019608
LOWER IN presence of tobacco plants0.019608
presence of tobacco plants0.019608
LOWER IN absence of tobacco plants0.019608
Exp. ID User ID Description Date Region Flag Sequences
205amnonhigh freq. in Ely Greenstone rock piles (dominant united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 5
548amnondominant rock, brazil, minas gerais state, campos rupestres2019-08-17v4No1 / 5
252amnonhigh freq. in river rock biofilm (dominant river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 8
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 9
514amnondominant united states of america, desert, sandstone, state of utah, grand staircase-escalante national park, depth (soil) 0-1cm2019-03-25v4No1 / 10
355amnonhigh freq. in rocks from low tide zone (dominant ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 11
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 12
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
811amnondominant glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 16
878amnondominant city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 16
355amnoncommon in rocks from high tide zone (dominant ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 17
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 18
763amnondominant glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 18
205amnonhigh freq. in rock piles from duluth complex (dominant united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 18
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
362amnon high in active vent compared to inactive vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 37
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 56
355amnonlower in rocks from low tide zone compared to high tide zone ( high in high tide zone compared to low tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 62
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
355amnonhigher in rocks from low tide zone compared to high tide zone ( high in low tide zone compared to high tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 74
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 74
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 78
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 120
362amnon high in inactive vent compared to active vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 129
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
514amnoncommon united states of america, desert, sandstone, state of utah, grand staircase-escalante national park, depth (soil) 0-1cm2019-03-25v4No1 / 139
355amnoncommon in rocks from high tide zone (common ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 148
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
878amnoncommon city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 203
205amnoncommon in rock piles from duluth complex (common united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 205
355amnoncommon in rocks from low tide zone (common ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 206
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 265
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 374
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 480
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
548amnoncommon rock, brazil, minas gerais state, campos rupestres2019-08-17v4No1 / 924
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org