Summary for ontology term: indian rhesus macaque

Number of annotations with term: 18

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTGTTAAGTCAGCGGTCAAATGTCAGGGCCCAACCTTGGCATGCCGTTGATACTGGTGGTCTTGAATTCACACAAGGAAGGTGGAATTCGTCGT0.518519
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAATAGCATTTCATACTGGGTTGCTAGAGTATTTTAGGGAGGGGTAGAATTCCACG0.461538
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__AlloscardoviaTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCTGGGTACGGGCAGGCTAGAGTGTAGTAGGGGAGACTGGAATTCCCGG0.451613
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.378378
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTTTTAAGCGTGTTGTGAAATGTAGAGGCTTAACCTCTGCACTGCAGCGCGAACTGGAGGGCTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.370370
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTAATTAAGTCTGATGTGAAAATGCGGGGCTCAACCCCGTATTGCGTTGGAAACTGGTTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.370370
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAAAGTTAAGTCAGCGGTAAAATCGAGAGGCTCAACCTCTTTTAGCCGTTGAAACTGGTTTTCTAGAGTGAGTGAGAAGTACGCGGAATGCGAGGT0.363636
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.363636
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTCTTTAAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGAAGGACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.350000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.344828

Annotations:

common ontology terms
term enrichment score
TermScore
cayo santiago0.666667
puerto rico0.666667
indian rhesus macaque0.666667
age 10-15 years0.400000
age > 1 year0.400000
age < 1 year0.333333
macaca mulatta0.285714
rectal swab0.250000
penis0.222222
adult organism0.181818
LOWER IN age 10-15 years0.181818
mouth mucosa0.166667
LOWER IN age &lt; 1 year0.166667
male organism0.133333
vagina0.117647
LOWER IN adult organism0.117647
oral cavity0.117647
female organism0.105263
LOWER IN penis0.095238
LOWER IN male organism0.074074
infant0.068966
LOWER IN vagina0.068966
LOWER IN female organism0.064516
LOWER IN infant0.057143
feces0.006309
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
age 10-15 years0.500000
age > 1 year0.500000
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
penis0.333333
LOWER IN penis0.333333
rectal swab0.200000
macaca mulatta0.166667
LOWER IN adult organism0.125000
adult organism0.125000
mouth mucosa0.111111
male organism0.111111
LOWER IN male organism0.111111
LOWER IN vagina0.090909
vagina0.090909
LOWER IN female organism0.076923
female organism0.076923
oral cavity0.071429
infant0.038462
LOWER IN infant0.038462
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
macaca mulatta1.000000
cayo santiago1.000000
puerto rico1.000000
indian rhesus macaque1.000000
infant0.333333
age < 1 year0.333333
oral cavity0.333333
mouth mucosa0.333333
age 10-15 years0.333333
adult organism0.333333
feces0.333333
rectal swab0.333333
age > 1 year0.333333
penis0.166667
male organism0.166667
vagina0.166667
female organism0.166667
LOWER IN age 10-15 years0.111111
LOWER IN adult organism0.111111
LOWER IN infant0.111111
LOWER IN age &lt; 1 year0.111111
LOWER IN vagina0.055556
LOWER IN female organism0.055556
LOWER IN penis0.055556
LOWER IN male organism0.055556
Exp. ID User ID Description Date Region Flag Sequences
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
770amnondominant oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 18
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396

Problems / suggestions? Please email info AT dbbact DOT org