Summary for ontology term: infant

Number of annotations with term: 241

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.034934
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.034934
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.026201
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.026201
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.026201
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.021834
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.021834
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.021834
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAACTCCTG0.021834
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.017467

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.357143
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.357143
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCTAACGGCTTAACCGTTAAACTGCTTGGGAAACTGATAATCTAGAGTAAGGGAGAGGCAGATGGAATTCTTGG0.357143
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGATTGGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTAGTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAAGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTTGAAACTGTCTAGCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCGATCAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGGTCGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.357143

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.258652
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.227692
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.225434
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.218623
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.210201
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.207792
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.205674
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.204986
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.202899
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.202091

Annotations:

common ontology terms
term enrichment score
TermScore
infant1.002669
1-month-old human stage0.231714
formula fed0.214815
homo sapiens0.192599
1-year-old human stage0.186464
breast fed0.175824
12-month-old human stage0.171749
age0.158228
saliva0.153182
3-month-old human stage0.144928
edo state0.138996
nasopharynx0.130011
feces0.121437
under-1-year-old human stage0.121140
6-month-old human stage0.109804
nigeria0.108761
LOWER IN infant0.107720
age < 3 years0.106870
sweden0.098059
state of victoria0.094276
child0.092430
kingdom of denmark0.092105
los angeles district0.090566
hispanic0.086643
macaca mulatta0.084806
hispanic or latin american0.083045
india0.081381
2-month-old human stage0.079681
gambia0.079681
kingdom of the netherlands0.079320
state of california0.078278
LOWER IN 1-year-old human stage0.076628
age 7 months0.076628
australia0.074380
nasal cavity0.070886
no dental caries0.064257
LOWER IN 1-month-old human stage0.063847
municipality of umea0.062257
indian rhesus macaque0.062257
cayo santiago0.062257
LOWER IN under-1-year-old human stage0.061069
finland0.059480
puerto rico0.058608
18-month-old human stage0.056988
LOWER IN breast fed0.056452
LOWER IN 12-month-old human stage0.055281
LOWER IN 3-month-old human stage0.054404
germany0.052597
LOWER IN formula fed0.048193
urban slum0.047431
dhaka0.047431
bangladesh0.046332
age < 1 year0.046332
supragingival dental plaque0.045283
supragingival plaque0.043796
infant stage0.042618
oral cavity0.041958
9-month-old human stage0.041068
age 1 week0.040107
2-year-old human stage0.039318
rural community0.037618
LOWER IN child0.034513
female0.033457
15-month-old human stage0.032653
newborn human stage0.032129
indonesia0.032129
municipality of yogyakarta0.032129
hypopharynx0.032129
oslo0.032129
LOWER IN age 7 months0.032129
venezuela0.031621
amerindian0.031621
estonia0.031621
bolivia0.031128
hunter gatherer0.030651
rectal swab0.030651
state of washington0.030651
kingdom of norway0.029304
mouth mucosa0.028470
russia0.028070
monkey0.026578
united states of america0.026042
adult0.025851
LOWER IN adult0.025851
kingdom of spain0.024615
LOWER IN 18-month-old human stage0.024590
LOWER IN 4-year-old human stage0.024590
4-year-old human stage0.024590
2-days-old human0.024291
age 0-6 months0.024291
vellore district0.024291
age 6-12 months0.024291
neonate0.024291
LOWER IN 2-year-old human stage0.024096
dentition0.024024
LOWER IN newborn human stage0.023715
age 1 year0.023437
age 2 months0.023437
LOWER IN infant stage0.021544
city0.019544
Fraction of dbbact annotations with this term covered by the query
TermScore
9-month-old human stage2.000000
18-month-old human stage1.500000
1-month-old human stage1.166667
infant1.100000
latvia1.000000
LOWER IN 18-month-old human stage1.000000
edo state1.000000
15-month-old human stage1.000000
formula fed1.000000
LOWER IN breast fed1.000000
LOWER IN 9-month-old human stage1.000000
6-month-old human stage1.000000
meconium1.000000
LOWER IN 4-year-old human stage1.000000
4-year-old human stage1.000000
2-month-old human stage1.000000
gambia1.000000
LOWER IN protein-energy malnutrition1.000000
LOWER IN severe malnutririon1.000000
LOWER IN malnutrition1.000000
severe malnutririon1.000000
protein-energy malnutrition1.000000
malnutrition1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
no dental caries1.000000
12-month-old human stage0.857143
LOWER IN 1-month-old human stage0.833333
LOWER IN formula fed0.750000
breast fed0.750000
LOWER IN age &gt; 3 months0.666667
age < 3 years0.666667
LOWER IN 2-month-old human stage0.666667
age 1 week0.600000
3-month-old human stage0.571429
LOWER IN 12-month-old human stage0.571429
1-year-old human stage0.555556
newborn human stage0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age &gt;=7 days0.500000
age <= 24 hours0.500000
LOWER IN acute respiratory illness0.500000
acute respiratory illness0.500000
2-days-old human0.500000
municipality of umea0.500000
LOWER IN 2-days-old human0.500000
fiji0.500000
LOWER IN mammalian milk beverage0.500000
mammalian milk beverage0.500000
LOWER IN 1-year-old human stage0.500000
urban slum0.500000
dhaka0.500000
age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN age 0-6 months0.500000
hypopharynx0.500000
oslo0.500000
vellore district0.500000
age 7 months0.500000
14-days-old human0.500000
LOWER IN age 7 months0.500000
LOWER IN age one week0.500000
age one week0.500000
4-month-old human stage0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
los angeles district0.500000
age 6-12 months0.500000
LOWER IN age 6-12 months0.500000
LOWER IN age 10-15 years0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
age 10-15 years0.500000
neonate0.500000
age 20 months0.500000
LOWER IN neonate0.500000
LOWER IN age 20 months0.500000
under-1-year-old human stage0.428571
LOWER IN 3-month-old human stage0.428571
LOWER IN infant0.400000
LOWER IN age 1 week0.400000
LOWER IN under-1-year-old human stage0.380952
2-year-old human stage0.375000
LOWER IN 2-year-old human stage0.375000
india0.375000
age0.333333
LOWER IN age &lt; 3 months0.333333
age > 3 months0.333333
age < 3 months0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.941909
infant0.921162
feces0.680498
germany0.165975
saliva0.157676
1-month-old human stage0.128631
formula fed0.120332
1-year-old human stage0.112033
age0.103734
breast fed0.099585
12-month-old human stage0.095436
nasopharynx0.082988
3-month-old human stage0.082988
united states of america0.082988
state of california0.082988
australia0.074689
nigeria0.074689
edo state0.074689
under-1-year-old human stage0.070539
sweden0.066390
LOWER IN infant0.062241
child0.062241
nasal cavity0.058091
kingdom of the netherlands0.058091
6-month-old human stage0.058091
age < 3 years0.058091
kingdom of denmark0.058091
state of victoria0.058091
los angeles district0.049793
hispanic0.049793
hispanic or latin american0.049793
macaca mulatta0.049793
india0.045643
LOWER IN 1-year-old human stage0.041494
2-month-old human stage0.041494
age 7 months0.041494
gambia0.041494
female0.037344
municipality of umea0.033195
LOWER IN under-1-year-old human stage0.033195
LOWER IN 1-month-old human stage0.033195
finland0.033195
no dental caries0.033195
indian rhesus macaque0.033195
cayo santiago0.033195
puerto rico0.033195
infant stage0.029046
LOWER IN 3-month-old human stage0.029046
18-month-old human stage0.029046
LOWER IN breast fed0.029046
LOWER IN 12-month-old human stage0.029046
adult0.024896
LOWER IN adult0.024896
oral cavity0.024896
urban slum0.024896
dhaka0.024896
bangladesh0.024896
supragingival plaque0.024896
supragingival dental plaque0.024896
LOWER IN formula fed0.024896
rural community0.024896
age < 1 year0.024896
LOWER IN child0.020747
9-month-old human stage0.020747
2-year-old human stage0.020747
age 1 week0.020747
newborn human stage0.016598
LOWER IN control0.016598
15-month-old human stage0.016598
russia0.016598
venezuela0.016598
hunter gatherer0.016598
amerindian0.016598
estonia0.016598
bolivia0.016598
indonesia0.016598
municipality of yogyakarta0.016598
hypopharynx0.016598
kingdom of norway0.016598
oslo0.016598
LOWER IN age 7 months0.016598
kingdom of spain0.016598
dentition0.016598
mouth mucosa0.016598
rectal swab0.016598
monkey0.016598
state of washington0.016598
research facility0.016598
LOWER IN newborn human stage0.012448
LOWER IN infant stage0.012448
control0.012448
2-days-old human0.012448
LOWER IN 18-month-old human stage0.012448
LOWER IN 2-year-old human stage0.012448
LOWER IN 4-year-old human stage0.012448
4-year-old human stage0.012448
age 0-6 months0.012448
age 1 year0.012448
vellore district0.012448
city0.012448
Number of experiments associating the term to the sequence
TermScore
infant33.000000
homo sapiens31.000000
feces23.000000
LOWER IN infant12.000000
1-year-old human stage10.000000
under-1-year-old human stage9.000000
LOWER IN 1-year-old human stage9.000000
LOWER IN under-1-year-old human stage8.000000
age7.000000
1-month-old human stage7.000000
saliva7.000000
child7.000000
12-month-old human stage6.000000
LOWER IN 1-month-old human stage5.000000
6-month-old human stage5.000000
adult5.000000
LOWER IN adult5.000000
3-month-old human stage4.000000
LOWER IN control4.000000
LOWER IN child4.000000
formula fed4.000000
LOWER IN breast fed4.000000
united states of america4.000000
LOWER IN 12-month-old human stage4.000000
nasopharynx3.000000
control3.000000
LOWER IN 3-month-old human stage3.000000
sweden3.000000
18-month-old human stage3.000000
2-year-old human stage3.000000
LOWER IN 2-year-old human stage3.000000
india3.000000
age 1 week3.000000
2-month-old human stage3.000000
LOWER IN formula fed3.000000
breast fed3.000000
newborn human stage2.000000
LOWER IN infant stage2.000000
LOWER IN age &gt; 3 months2.000000
infant stage2.000000
australia2.000000
LOWER IN 18-month-old human stage2.000000
9-month-old human stage2.000000
female2.000000
age < 3 years2.000000
oral cavity2.000000
finland2.000000
supragingival plaque2.000000
supragingival dental plaque2.000000
LOWER IN 4-year-old human stage2.000000
4-year-old human stage2.000000
kingdom of denmark2.000000
LOWER IN age 1 week2.000000
gambia2.000000
LOWER IN 2-month-old human stage2.000000
state of california2.000000
macaca mulatta2.000000
LOWER IN newborn human stage1.000000
nasal cavity1.000000
kingdom of the netherlands1.000000
age <=24 hours1.000000
LOWER IN age &gt;= 7 days1.000000
age 24 hours1.000000
LOWER IN age 2 hours1.000000
LOWER IN age &gt;=7 days1.000000
LOWER IN age &lt; 3 months1.000000
age > 3 months1.000000
age <= 24 hours1.000000
LOWER IN acute respiratory illness1.000000
acute respiratory illness1.000000
latvia1.000000
2-days-old human1.000000
municipality of umea1.000000
LOWER IN 2-days-old human1.000000
nigeria1.000000
edo state1.000000
15-month-old human stage1.000000
fiji1.000000
age < 3 months1.000000
LOWER IN 9-month-old human stage1.000000
russia1.000000
venezuela1.000000
hunter gatherer1.000000
amerindian1.000000
LOWER IN mammalian milk beverage1.000000
mammalian milk beverage1.000000
meconium1.000000
urban slum1.000000
dhaka1.000000
bangladesh1.000000
estonia1.000000
bolivia1.000000
age 0-6 months1.000000
indonesia1.000000
municipality of yogyakarta1.000000
LOWER IN age 0-6 months1.000000
hypopharynx1.000000
kingdom of norway1.000000
oslo1.000000
age 1 year1.000000
vellore district1.000000
city1.000000
germany1.000000
age 7 months1.000000
rural community1.000000
14-days-old human1.000000
LOWER IN protein-energy malnutrition1.000000
LOWER IN severe malnutririon1.000000
LOWER IN malnutrition1.000000
LOWER IN age 7 months1.000000
severe malnutririon1.000000
protein-energy malnutrition1.000000
malnutrition1.000000
LOWER IN age one week1.000000
age one week1.000000
kingdom of spain1.000000
4-month-old human stage1.000000
LOWER IN bifidobacterium supplement1.000000
bifidobacterium supplement1.000000
state of victoria1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
no dental caries1.000000
age 2 months1.000000
dentition1.000000
los angeles district1.000000
hispanic1.000000
hispanic or latin american1.000000
age 6-12 months1.000000
LOWER IN age 6-12 months1.000000
LOWER IN age 10-15 years1.000000
mouth mucosa1.000000
indian rhesus macaque1.000000
cayo santiago1.000000
puerto rico1.000000
age < 1 year1.000000
age 10-15 years1.000000
rectal swab1.000000
neonate1.000000
monkey1.000000
state of washington1.000000
research facility1.000000
age 20 months1.000000
LOWER IN neonate1.000000
LOWER IN age 20 months1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
919amnon high in breast fed compared to formula fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 1approvedNo
227amnonpeaks at age 1 month in baby nasopharynx ( high in 1-month-old human stage age compared to infant stage newborn human stage in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
227amnonpeaks at age 3 months in baby nasopharynx ( high in 3-month-old human stage age compared to infant stage age > 3 months age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
227amnonlower in infants with respiratory illness compared to healthy controls ( high in control compared to respiratory system disease in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v41 / 2approvedNo
966amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant gambia rural community homo sapiens feces 2022-12-21v31 / 3approvedNo
966amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens rural community gambia infant 2022-12-21v31 / 3approvedNo
966amnon high in severe malnutririon protein-energy malnutrition malnutrition compared to control in feces homo sapiens rural community gambia infant 1-year-old human stage 2022-12-21v31 / 3approvedNo
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 3approvedNo
919amnon high in formula fed compared to breast fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 3approvedNo
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v41 / 4approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 4approvedNo
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in 2-month-old human stage homo sapiens infant vellore district city india )2018-05-14v41 / 5approvedNo
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 5approvedNo
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 5approvedNo
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in newborn human stage age age 24 hours compared to newborn human stage age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 6approvedNo
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v41 / 6approvedNo
966amnon high in control compared to protein-energy malnutrition severe malnutririon malnutrition in 1-year-old human stage infant gambia rural community homo sapiens feces 2022-12-21v31 / 6approvedNo
919amnondominant 2-month-old human stage, 1-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 6approvedNo
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 7approvedNo
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 7approvedNo
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
960amnoncommon meconium, newborn human stage, infant, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 8approvedNo
332amnoncommon 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v41 / 8approvedNo
777amnondominant 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 8approvedNo
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v41 / 8approvedNo
859amnon high in 1-month-old human stage compared to 6-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 8approvedNo
227amnoncommon in baby nasopharynx age 1 day to 3 months (common 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 9approvedNo
332amnondominant 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v41 / 9approvedNo
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 9approvedNo
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 9approvedNo
227amnoncommon in baby nasopharynx age 6 months to 1 year (common 12-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands)2017-10-30v41 / 10approvedNo
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant 12-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 10approvedNo
1019amnoncommon latvia, under-1-year-old human stage, infant, feces, homo sapiens2023-04-03v31 / 10approvedNo
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 10approvedNo
919amnoncommon saliva, 2-month-old human stage, 1-month-old human stage, infant, state of victoria, australia, homo sapiens2022-07-17v41 / 10approvedNo
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 10approvedNo
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, infant, nasopharynx, australia)2017-04-16v41 / 11approvedNo
533amnoncommon 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v41 / 11approvedNo
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 11approvedNo
848amnoncommon 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 11approvedNo
919amnondominant state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 11approvedNo
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 12approvedNo
533amnondominant 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v41 / 12approvedNo
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 12approvedNo
777amnondominant 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 12approvedNo
797amnoncommon breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 12approvedNo
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 12approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v41 / 13approvedNo
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v41 / 13approvedNo
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 13approvedNo
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 13approvedNo
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 14approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v41 / 14approvedNo
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 14approvedNo
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 14approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 14approvedNo
797amnondominant breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 14approvedNo
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 14approvedNo
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 14approvedNo
227amnonhigher in age > 3 months in baby nasopharynx ( high in infant stage age age > 3 months compared to age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 15approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v41 / 15approvedNo
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v41 / 15approvedNo
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v41 / 15approvedNo
777amnoncommon 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 15approvedNo
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 15approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 15approvedNo
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 15approvedNo
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v41 / 16approvedNo
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v41 / 16approvedNo
892amnondominant 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 16approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 16approvedNo
922amnondominant no dental caries, 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-07-25v41 / 16approvedNo
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 17approvedNo
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, 15-month-old human stage, oral cavity2022-12-20v41 / 17approvedNo
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v41 / 17approvedNo
797amnon high in breast fed compared to formula fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 17approvedNo
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 17approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
966amnoncommon infant, 1-year-old human stage, gambia, rural community, homo sapiens, feces2022-12-21v31 / 18approvedNo
777amnoncommon 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 18approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 18approvedNo
848amnoncommon 6-month-old human stage, infant, kingdom of spain, feces, homo sapiens2021-12-13v11 / 18approvedNo
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 18approvedNo
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 19approvedNo
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 19approvedNo
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
227amnoncommon in baby nasopharynx age <= 1 day (common 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 20approvedNo
892amnondominant 1-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, infant, united states of america, homo sapiens2022-04-07v41 / 20approvedNo
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v31 / 20approvedNo
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v41 / 20approvedNo
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 20approvedNo
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
922amnondominant no dental caries, 1-year-old human stage, supragingival dental plaque, supragingival plaque, infant, dentition, united states of america, homo sapiens2022-07-25v41 / 20approvedNo
1019amnondominant homo sapiens, feces, infant, under-1-year-old human stage, latvia2023-04-03v31 / 21approvedNo
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v41 / 21approvedNo
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v41 / 21approvedNo
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v41 / 21approvedNo
848amnondominant 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 21approvedNo
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 21approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 15-month-old human stage2022-12-20v41 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v41 / 22approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 22approvedNo
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 22approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 22approvedNo
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v41 / 23approvedNo
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v41 / 23approvedNo
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v41 / 23approvedNo
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 23approvedNo
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 23approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v41 / 24approvedNo
960amnoncommon 9-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 24approvedNo
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v41 / 24approvedNo
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v41 / 24approvedNo
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v11 / 24approvedNo
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 25approvedNo
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 25approvedNo
848amnondominant 6-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 25approvedNo
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 25approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 25approvedNo
770amnondominant age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 25approvedNo
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v31 / 26approvedNo
966amnondominant feces, homo sapiens, rural community, gambia, 1-year-old human stage, infant2022-12-21v31 / 26approvedNo
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v41 / 27approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 27approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 28approvedNo
892amnoncommon supragingival plaque, supragingival dental plaque, 1-year-old human stage, dental plaque, infant, united states of america, homo sapiens2022-04-07v41 / 29approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 29approvedNo
922amnoncommon dentition, supragingival plaque, supragingival dental plaque, infant, 1-year-old human stage, no dental caries, united states of america, homo sapiens2022-07-25v41 / 29approvedNo
960amnoncommon 15-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 30approvedNo
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 30approvedNo
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 30approvedNo
233amnon high in age age < 3 months compared to infant stage age > 3 months in feces homo sapiens infant united states of america 2017-11-05v41 / 31approvedNo
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v41 / 31approvedNo
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 31approvedNo
892amnoncommon 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 33approvedNo
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 33approvedNo
922amnoncommon no dental caries, infant, 1-year-old human stage, saliva, united states of america, homo sapiens2022-07-25v41 / 33approvedNo
919amnoncommon 9-month-old human stage, 8-month-old human stage, 7-month-old human stage, 6-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 34approvedNo
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 35approvedNo
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v41 / 35approvedNo
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 35approvedNo
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in 1-month-old human stage age age 1 week compared to 3-month-old human stage in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v41 / 35approvedNo
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 35approvedNo
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v41 / 35approvedNo
960amnoncommon oral cavity, 15-month-old human stage, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 36approvedNo
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v41 / 36approvedNo
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v41 / 37approvedNo
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 37approvedNo
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v31 / 37approvedNo
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v41 / 38approvedNo
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v41 / 39approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 39approvedNo
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v11 / 39approvedNo
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 40approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v41 / 41approvedNo
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v41 / 42approvedNo
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 43approvedNo
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v41 / 44approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 45approvedNo
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v41 / 46approvedNo
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 46approvedNo
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in mouth mucosa oral cavity indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 49approvedNo
960amnoncommon 18-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 50approvedNo
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v41 / 50approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v31 / 52approvedNo
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 56approvedNo
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 59approvedNo
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v41 / 60approvedNo
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 62approvedNo
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 63approvedNo
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 65approvedNo
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 69approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 72approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 75approvedNo
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 79approvedNo
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v41 / 80approvedNo
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v41 / 83approvedNo
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in puerto rico cayo santiago macaca mulatta indian rhesus macaque oral cavity mouth mucosa 2021-04-19v41 / 84approvedNo
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in newborn human stage age age <=24 hours compared to newborn human stage age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 85approvedNo
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 87approvedNo
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 104approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 106approvedNo
273amnon high in 1-month-old human stage age compared to 1-month-old human stage age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 107approvedNo
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 111approvedNo
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in 3-month-old human stage age compared to 1-month-old human stage age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v41 / 116approvedNo
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 127approvedNo
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v31 / 139approvedNo
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 145approvedNo
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 146approvedNo
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 148approvedNo
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 155approvedNo
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v41 / 157approvedNo
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 164approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v41 / 167approvedNo
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 169approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v41 / 173approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 188approvedNo
777amnon high in 3-month-old human stage compared to 2-days-old human in infant homo sapiens saliva sweden municipality of umea 2021-04-26v31 / 197approvedNo
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 200approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 212approvedNo
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v41 / 216approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 244approvedNo
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 253approvedNo
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 280approvedNo
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 304approvedNo
723amnon high in 2-5 year-old child stage compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v31 / 305approvedNo
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v41 / 306approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v41 / 363approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 407approvedNo
339amnon high in adult compared to under-1-year-old human stage infant in homo sapiens feces india 2018-05-24v41 / 457approvedNo
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 567approvedNo
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 583approvedNo
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 1065approvedNo
960amnon high in female adult compared to 18-month-old human stage infant in feces edo state nigeria homo sapiens 2022-12-20v41 / 1392approvedNo

Problems / suggestions? Please email info AT dbbact DOT org