Summary for ontology term: ireland

Number of annotations with term: 22

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCGTCCGTGAAAACTTGGGGCTCAACCTCAAGCTTGCGGGCGATACGGGCAGACTTGAGTACTGCAGGGGAGACTGGAATTCCTGG0.045455
d__BacteriaTACGGAGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGTGGCCCGTTAAGTGGCTGGTGAAATCCCGCGGCTCAACTGCGGGGCTGCCGGTCAGACTGGCGAGCTAGAGCACGGTAGGGGCAGATGGAATTCCCGG0.045455
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCGGTCCCACAAGTCCTCCGTTAAATCCAACTGCTTAACAGATGGGCCGCGGAGGATACTATGGGGCTAGGAGGCAGGAGAGGCAAGCGGTACTCAGTG0.045455
d__BacteriaTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGCTGGGCAAGTCCGATGTGAAAGCTTCCGGCTTAACTGGAAAATTGCATCGGAAACTGCTCGGCTTGAAGGTGGGAGAGGGTAGCGGAATTCCCGG0.045455
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__NocardioidaceaeTACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACACGGGGCTTAACTCCGTGCCTGCTTCCGATACGGGCAGACTAGAGGTATGCAGGGGAGAACGGAATTCCTGG0.045455
d__Bacteria;p__"Proteobacteria"TACGGAAGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCGCGTAGGCGGCTTGGCAAGTGAGGCGTGAAAGTCCTGGGCTCAACCCGGGGACGGCGCTTCAGACTGCGGGGCTAGAGTCCGGAAGAGGGTGGTGGAATTCCGAG0.045455
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGCAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATAGCTGGAGTACGGTAGAGGGGGATGGAATTCCGCG0.045455
d__Bacteria;p__"Proteobacteria"TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGTAGGCGGTTCTTTGTGTCCGCTGTGAAATCCCCGGGCTTAACCTGGGAATGGCAGTGGAAACTAGAGGACTTGAATCCGGCAGAGGGGGGTGGAATGCCACG0.045455
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTTTCAAGCTTGATGTGAAAGCCCCGGGCTTAACCTGGGAATGGCATTGAGGACTGAGAGGCTAGAGTGCGGCAGAGGGAGGTGGAATTCCACG0.045455
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__AcidimicrobialesCACGTAGGGGCCAAGCGTTGTCCGGATTCATTGGGCGTAAAGAGCTCGTAGGCGGTTCAGTCAGTCGGGTGTGAAATCTCCGGGCTCAACTCGGAGGGGCCACCCGATACTGCTGTGACTCGAGTCCGGTAGGGGAGTGGGGAATTCCTG0.045455

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTAATTAAGTCAGCGGTGAAATTCCACAGCTCAACTGTGGAACTGCCATTGATACTGGTTGGCTTGAGTACAGATGAGGTAGGCGGAATTGACAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTAATTAAGTCAGCGGTGAAATTCTACAGCTTAACTGTTAGAACTGCCATTGATACTGGTTGGCTTGAGTACAGATGAGGTAGGCGGAATTGACA0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__MassiliaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCTGTCGTGAAATCCCCGGGCTCAACCTGGGAATTGCGATGGAGACTGCAAGGCTAGAATCTGGCAGAGGGGGGTAGAATTCCACG0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGCTTGTAAGTCAGTGGTGAAATCTCCGGGCTTAACCCGGAAACTGCCATTGATACTATAAGTCTTGAATACCATGGAGGTGAGCGGAATATGTCA0.500000
d__Bacteria;p__"Bacteroidetes"TACGAAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGTCTTATAAGTCAGTGGTGAAATCTCGTTGCTTAACAACGAACGTGCCATTGATACTGTAGGACTTGAGTACAGTTGCCGTTGGCGGAATGTGTCA0.500000
d__Bacteria;p__"Verrucomicrobia";c__Opitutae;o__Opitutales;f__Opitutaceae;g__OpitutusTACAGAGACTGCAAGCGTTATTCGGATTCACTGGGCGTAAAGGGTGCGCAGGCGGCCAAGTGTGTTAGGCGTGAAAGCCCGGGGCTTAACCCCGGAATTGCACCTAAAACTACATGGCTAGAGCATTGGAGAGGGTAGCGGAATTCACGG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGTGTAGGCGGACTTTTAAGTCAGCGGTGAAATCTCCGGGCTCAACCCGGAAACTGCCATTGATACTATTGGTCTTGAATGTTGTTGAGGTGGGCGGAACGGGTCA0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__ParafilimonasTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGCAGGCGGATATGTAAGTCAGTGGTGAAATCTTTGGGCTTAACCCGAAAATTGCCATTGATACTATATATCTTGAATGCTGTGGAGGTAAGCGGAATATGTCA0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGCGGCCAACTAAGTCGGATGTGAAATCCCCAGGCTCAACTTGGGAACTGCATCCGATACTGGATGGCTTGAATTCGGGAGAGGGATGCAGAATTCCAGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACGGTAATGGGAGTGGAAAATCCATTACGTGACGGTAACTAACCAGAAAGGGACGG0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCACAGGCCGGCTGTCAAGCGTGTTGTGAAATGTAGGGGCTCAACCTCTGAACTGCAGCGCGAACTGACGGTCTTGAGTGCGCGCAACGTTGGCGGAATTCGTCG0.333333
d__BacteriaTAATAAAAATGAAGCCATAAACGAAAGTTTGACTAAGTTATATTGATTAGGGTTGGTAAATCTTGTGCCAGCCACCACGGTCATATGATTAACCCAAGTTAACAAGAATACAGCATAAAGCATGCTAAAGCATTACACCAAATAGAGTTA0.322581
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGCTGTTAAGCGTGACGTGAAATGCTGGGGCTCAACCTTGGCCTGCGTCGCGAACTGGCGGCCTTGAGTGGACGGTAGGCAGGCGGAATTCGTGGT0.312500
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATTTGCAAGTCAGATGTGAAAGGCGGGGGCTTAACCCCTGGATTGCATTTGAAACTGCAGATCTTGAGTACCGGAAGGGCAGATGGAATTCCTGG0.312500
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTCAGCAAGTCCGATGTGAAAGGCGGAGGCTCAACTTCCGAATTGCATTGGAAACTGTCGGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.303030
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCACAGGCCGGCTGTCAAGCGTGTTGTGAAATGTAGGCGCTCAACGCCTGACTTGCAGCGCGAACTGACGGTCTTGAGTGCGCGCAACGTTGGCGGAATTTGTCG0.303030
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAGAAGCAAGTCTGATGTGAAAGCCCGCGGCTCAACCGCGGGACTGCATTGGAAACTGCTTCTCTGGAGTACTGGAAGGGCAAGCGGAATTCCTGG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCTGTGCAAGTCTGAAGTGAAAACCCTCGGCTCAACTGAGGAATTGCTTTGGAAACTGTATAGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTGG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGAGAGCGTAGACGGTAATGTAAGTCTGAAGTGAAATGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTATATAACTGGAGTACCGGAGGGGTAAGCGGAATTCCTGG0.296296

Annotations:

common ontology terms
term enrichment score
TermScore
ireland0.870466
holstein-friesian bull0.421053
milk0.300000
age 100 days0.266667
cow milk (raw)0.235294
pasture0.235294
lamb0.210526
bulk tank milk0.153846
skimmed milk powder0.153846
milk powder0.153846
milk collection tanker0.153846
rumen0.150000
cow milk based food product0.142857
cow milk (fluid)0.142857
sheep0.121212
ovis aries0.108108
bos taurus0.096386
farm0.094118
diet0.083916
linseed oil food product0.083333
LOWER IN linseed oil food product0.083333
LOWER IN normal feed0.083333
LOWER IN restricted diet0.083333
660 days0.083333
LOWER IN 605 days0.083333
605 days0.083333
LOWER IN 660 days0.083333
LOWER IN rumen solids0.083333
rumen solids0.083333
restricted feed0.080000
LOWER IN new zealand0.074074
new zealand0.074074
LOWER IN ireland0.074074
normal diet0.074074
rumen liquid0.074074
LOWER IN rumen liquid0.074074
ph 6-70.066667
age0.062500
LOWER IN control diet0.054054
control diet0.054054
child0.044944
soil0.018779
LOWER IN control0.009434
control0.009434
Fraction of dbbact annotations with this term covered by the query
TermScore
ireland0.800000
bulk tank milk0.500000
skimmed milk powder0.500000
milk powder0.500000
milk collection tanker0.500000
age 100 days0.500000
linseed oil food product0.500000
LOWER IN linseed oil food product0.500000
holstein-friesian bull0.500000
LOWER IN normal feed0.500000
LOWER IN restricted diet0.500000
660 days0.500000
LOWER IN 605 days0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN rumen solids0.500000
rumen solids0.500000
cow milk (raw)0.333333
milk0.333333
cow milk based food product0.333333
cow milk (fluid)0.333333
pasture0.333333
restricted feed0.333333
lamb0.250000
LOWER IN new zealand0.200000
new zealand0.200000
LOWER IN ireland0.200000
normal diet0.200000
rumen liquid0.200000
LOWER IN rumen liquid0.200000
sheep0.090909
rumen0.086957
ovis aries0.076923
LOWER IN control diet0.066667
control diet0.066667
diet0.060606
bos taurus0.055556
farm0.054054
ph 6-70.052632
age0.047619
child0.025641
soil0.009901
LOWER IN control0.005263
control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
ireland0.954545
rumen0.545455
farm0.363636
bos taurus0.363636
holstein-friesian bull0.363636
milk0.272727
cow milk (raw)0.181818
ovis aries0.181818
sheep0.181818
lamb0.181818
child0.181818
age 100 days0.181818
soil0.181818
pasture0.181818
diet0.136364
bulk tank milk0.090909
cow milk based food product0.090909
skimmed milk powder0.090909
milk powder0.090909
milk collection tanker0.090909
cow milk (fluid)0.090909
ph 6-70.090909
age0.090909
LOWER IN control diet0.045455
linseed oil food product0.045455
control diet0.045455
LOWER IN linseed oil food product0.045455
LOWER IN new zealand0.045455
new zealand0.045455
LOWER IN ireland0.045455
restricted feed0.045455
LOWER IN control0.045455
LOWER IN normal feed0.045455
control0.045455
LOWER IN restricted diet0.045455
normal diet0.045455
660 days0.045455
LOWER IN 605 days0.045455
605 days0.045455
LOWER IN 660 days0.045455
rumen liquid0.045455
LOWER IN rumen solids0.045455
rumen solids0.045455
LOWER IN rumen liquid0.045455
Exp. ID User ID Description Date Region Flag Sequences
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 1
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 4
480amnondominant soil, pasture, farm, ireland2019-02-05v4No1 / 8
888amnondominant bulk tank milk, cow milk (raw), ireland, milk2022-03-30v3No1 / 9
888amnondominant milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v3No1 / 14
888amnondominant skimmed milk powder, milk powder, cow milk based food product, ireland, milk2022-03-30v3No1 / 15
491amnondominant ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 16
83amnondominant bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 16
480amnon high in new zealand compared to ireland in soil pasture farm ph 6-7 2019-02-05v4No1 / 20
83amnonhigher in rumen liquids compared to solids in normal diet cows ( high in rumen liquid compared to rumen solids in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 40
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 80
480amnon high in ireland compared to new zealand in soil pasture farm ph 6-7 2019-02-05v4No1 / 94
888amnoncommon cow milk based food product, skimmed milk powder, milk powder, ireland, milk2022-03-30v3No1 / 105
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 248
888amnoncommon milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v3No1 / 353
888amnoncommon bulk tank milk, cow milk (raw), milk, ireland2022-03-30v3No1 / 388
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735

Problems / suggestions? Please email info AT dbbact DOT org