Summary for ontology term: irritable bowel syndrome

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGCAAGTCTGATGTGAAATTCCAGGGCTTAACCCTGGACCTGCATTGGAAACTGTATAACTAGAGTGTCGGAGAGGTGAGTGGAATTCCTAG0.166667
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__PedobacterTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTATTAAGTCAGGGGTGAAAGACGGTGGCTCAACCATCGCAGTGCCCTTGATACTGATGAGCTTGAATACACTAGAGGTAGGCGGAATGTGACA0.166667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGCAGCTAGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACGGGCAAGTCTGAAGTGAAAGGCAGGGGCTCAACCCCTGGACTGCTTTGGAAACTGTCCATCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGAAGTGAAATCCCGGGGCTCAACCCCGGTGCTGCTTTGGAAACTGTTAGGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.166667

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTAGATCTTGAGTGTCGGAGGGGCAATCGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGATTGGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTAGTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__CoprococcusTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCGGAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACGGCTTTTGAAACTGCCCTGCTTGATTTCAGGAGAGGTAAGCGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGCAGGCAAGTCAGGCGTGAAATATATCGGCTCAACCGGTAACGGCGCTTGAAACTGCAGGTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCTAGT1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATACAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTATCTCTTGAGTGTCGGAGAGGTAGACGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGTTACCTAAGCACGAGGTATAAGGCAATGGCTTAACCATTGTTCGCCTTGTGAACTGGGCTACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT1.000000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGAAGTGAAATCCCGGGGCTCAACCCCGGTGCTGCTTTGGAAACTGTTAGGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTCCTTTAAGCGTGCTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGACTTGAGTACGCACGAGGTAGGCGGAATTCGTGG0.052632
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__CoprobacterTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAAGAATAAGTCAGCGGTGAAATGCTTCAGCTCAACTGGAGAATTGCCGATGAAACTGTTTTTCTAGAGTATAAAAGAGGTATGCGGAATGCGTGG0.047619
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTAGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.044444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGCAAGTCTGATGTGAAATTCCAGGGCTTAACCCTGGACCTGCATTGGAAACTGTATAACTAGAGTGTCGGAGAGGTGAGTGGAATTCCTAG0.043478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATTGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTAGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.041667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGGCGTGAAAACCAGGGGCTCAACCTCTGGCCTGCGTTTGAAACTGTAGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.040816
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTTTTAAGTTAGAGGTGAAAGCTCGACGCTCAACGTCGAAATTGCCTCTGATACTGAGAGACTAGAGTGTAGTTGCGGAAGGCGGAATGTGTGG0.035714
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTGAAAAGTCGGATGTGAAATCCCCGTGCTTAACATGGGAGCTGCATTCGAAACTTTCGGACTTGAGTGTCGGAGAGGTAAGCGGAATTCCCGG0.032258
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.031496

Annotations:

common ontology terms
term enrichment score
TermScore
irritable bowel syndrome0.909091
LOWER IN irritable bowel syndrome0.666667
kingdom of spain0.088889
human adult stage0.080000
adult0.022857
LOWER IN control0.020942
control0.020942
homo sapiens0.014652
feces0.012658
united states of america0.008000
Fraction of dbbact annotations with this term covered by the query
TermScore
irritable bowel syndrome1.000000
LOWER IN irritable bowel syndrome1.000000
kingdom of spain0.047619
human adult stage0.045455
adult0.011561
LOWER IN control0.010811
control0.010811
homo sapiens0.007380
feces0.006369
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
adult1.000000
irritable bowel syndrome0.833333
kingdom of spain0.666667
LOWER IN irritable bowel syndrome0.500000
LOWER IN control0.333333
control0.333333
united states of america0.333333
human adult stage0.333333

Problems / suggestions? Please email info AT dbbact DOT org