Summary for ontology term: israel

Number of annotations with term: 96

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATTGCAAGTCAGATGTGAAATGCAGAGGCTTAACCTCTGAGCTGCATTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.152542
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGGCGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAACTGCTCTCAAAACTGTGCCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.151261
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGACGGGGTTAATAACCCTGTCGATTGACGTTACCCGCAGAAGAAGCACCGGC0.147541
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTAAGGTAAGTCAGCGGTGAAATGCCCCCGCTCAACGGGGTGAAGTGCCATTGATACTGCCTTGCTGGAATGCGGATGCCGTGGGAGGAATGTGTG0.145161
d__BacteriaTGGGGAATCTTGGACAATGGGCGAAAGCCCGATCCAGCAATATCGCGTGAGTGAAGAAGGGCAATGCCGCTTGTAAAGCTCTTTCGTCGAGTGCGCGATCATGACAGGACTCGAGGAAGAAGCCCCGGCTAACTCCGTGCCAGCAGCCGC0.145078
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGTCCTTGAGTACAGTTGAGGTGGGCGGAATTCGTGG0.138889
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGACGGCCGAGTAAGTTATAGGTGAAAGCCCATCTTTCAAGGATGGAATTGCCTGTAATACTGCCTGGCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTAG0.136752
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Cellulomonadaceae;g__CellulomonasTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACTTCAGGCTCAACCTGGGGCTTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGTGACTGGAATTCCTGG0.130081
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGAGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.128655
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGAGCGGCAAGTTGGAGGTGAAACTCATGGGCTCAACCCATGAACTGCCTTCAAAACTGTCGGTCTTGAGTGGTGTAGAGGTAAGCGGAATTCCCGG0.128440

Annotations:

common ontology terms
term enrichment score
TermScore
israel0.969697
irrigated0.213115
neve yaar0.172414
rattus norvegicus0.144330
rat0.126126
vertisol0.111111
northen israel0.111111
size < 10um0.111111
age 4-10 years0.111111
negev desert0.111111
dahl salt-sensitive0.111111
potting mix0.105263
dust0.105263
food allergy0.105263
sandy loam soil0.105263
solanum lycopersicum0.096552
zea mays subsp. mays0.094340
sprague dawley0.090909
whole plant0.090090
corn0.090090
bulk soil0.086957
control diet0.085106
agricultural field0.083333
depth (soil) 0-10cm0.080000
medicago sativa0.076923
alfalfa sprouts0.076923
producer c20.076923
vigna radiata0.076923
producer c10.076923
mung bean sprouts0.076923
triticum aestivum0.074074
air0.068966
soil0.067066
no tillage0.058824
treated wastewater0.058824
clear day0.058824
dust storm0.058824
milk allergy0.058824
sesame allergy0.058824
salt0.058824
salt rich diet0.058824
tap water0.057143
unamended0.057143
ph 7-80.057143
research facility0.055624
conventional tillage0.055556
fructose diet0.055556
fructose0.055556
pregnancy0.054054
wastewater treatment plant0.052632
c57bl/60.051020
drinking water0.050000
biochar0.050000
diarrhea0.048780
antibiotic0.048780
food product type0.047619
mouse0.045234
feces0.043932
mus musculus0.042360
clay soil0.040000
loam0.040000
loamy sand soil0.040000
fruit0.040000
ph 7.30.040000
fermented corn0.040000
LOWER IN fresh corn0.040000
loam soil0.039216
cucumis sativus0.039216
pancreatic cancer0.039216
first trimester0.039216
third trimester0.039216
nectar0.039216
cucumber0.038462
neomycin0.038462
surface0.037736
ph 6.50.037736
flower0.037736
ampicillin0.037736
child0.036364
LOWER IN control diet0.036036
male0.035714
rhizosphere0.032941
control0.031496
water0.028169
LOWER IN control0.027972
homo sapiens0.025872
female0.022222
LOWER IN treated wastewater0.020408
amended with biochar0.020408
LOWER IN amended with biochar0.020408
LOWER IN clear day0.020408
LOWER IN dust day0.020408
LOWER IN sesame allergy0.020408
LOWER IN milk allergy0.020408
artificial wastewater irrigation0.020408
LOWER IN tap water irrigation0.020408
LOWER IN fertilized water irrigation0.020408
LOWER IN treated wastewater irrigation0.020408
nicotiana galuca0.020408
nicotiana glauca0.020408
Fraction of dbbact annotations with this term covered by the query
TermScore
israel0.941176
vertisol0.500000
northen israel0.500000
no tillage0.500000
treated wastewater0.500000
LOWER IN treated wastewater0.500000
medicago sativa0.500000
alfalfa sprouts0.500000
producer c20.500000
neve yaar0.500000
irrigated0.500000
clay soil0.500000
loam0.500000
loamy sand soil0.500000
fruit0.500000
vigna radiata0.500000
producer c10.500000
mung bean sprouts0.500000
ph 7.30.500000
amended with biochar0.500000
LOWER IN amended with biochar0.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
LOWER IN clear day0.500000
LOWER IN dust day0.500000
milk allergy0.500000
LOWER IN sesame allergy0.500000
age 4-10 years0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
negev desert0.500000
artificial wastewater irrigation0.500000
LOWER IN tap water irrigation0.500000
LOWER IN fertilized water irrigation0.500000
LOWER IN treated wastewater irrigation0.500000
nicotiana galuca0.500000
nicotiana glauca0.500000
fertilized water irrigation0.500000
treated wastewater irrigation0.500000
tapwater irrigation0.500000
LOWER IN artificial wastewater irrigation0.500000
LOWER IN heat stressed soil0.500000
heat stressed soil0.500000
dss induced colitis0.500000
LOWER IN dss induced colitis0.500000
LOWER IN il-1alpha knockout0.500000
il-1alpha knockout0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
dahl salt-sensitive0.500000
salt0.500000
salt rich diet0.500000
LOWER IN no tillage0.500000
zea mays subsp. mays0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
days 900.500000
tap water0.333333
LOWER IN tap water0.333333
dry0.333333
LOWER IN dry0.333333
loam soil0.333333
cucumis sativus0.333333
potting mix0.333333
unamended0.333333
LOWER IN pancreatic cancer0.333333
pancreatic cancer0.333333
LOWER IN unamended0.333333
dust0.333333
food allergy0.333333
probiotic0.333333
first trimester0.333333
third trimester0.333333
sandy loam soil0.333333
nectar0.333333
whole plant0.333333
corn0.333333
LOWER IN time 00.333333
day 00.333333
LOWER IN day 00.333333
conventional tillage0.250000
LOWER IN irrigated0.250000
cucumber0.250000
LOWER IN conventional tillage0.250000
LOWER IN fructose diet0.250000
LOWER IN fructose0.250000
fructose diet0.250000
fructose0.250000
neomycin0.250000
surface0.200000
ph 6.50.200000
flower0.200000
ampicillin0.200000
wastewater treatment plant0.166667
LOWER IN wastewater treatment plant0.166667
bulk soil0.142857
Fraction of annotations for the query sequences containing the term
TermScore
israel1.000000
feces0.416667
research facility0.281250
soil0.218750
homo sapiens0.197917
rattus norvegicus0.145833
rat0.145833
irrigated0.135417
neve yaar0.104167
adult0.093750
food product type0.083333
depth (soil) 0-10cm0.083333
agricultural field0.083333
sprague dawley0.083333
male0.083333
rhizosphere0.072917
solanum lycopersicum0.072917
mus musculus0.072917
mouse0.072917
bulk soil0.062500
triticum aestivum0.062500
vertisol0.062500
northen israel0.062500
water0.062500
potting mix0.062500
control0.062500
air0.062500
dust0.062500
size < 10um0.062500
child0.062500
food allergy0.062500
age 4-10 years0.062500
negev desert0.062500
sandy loam soil0.062500
ph 7-80.062500
control diet0.062500
dahl salt-sensitive0.062500
c57bl/60.052083
zea mays subsp. mays0.052083
whole plant0.052083
corn0.052083
medicago sativa0.041667
alfalfa sprouts0.041667
producer c20.041667
vigna radiata0.041667
producer c10.041667
mung bean sprouts0.041667
LOWER IN control0.041667
female0.041667
pregnancy0.041667
no tillage0.031250
conventional tillage0.031250
wastewater treatment plant0.031250
treated wastewater0.031250
drinking water0.031250
tap water0.031250
biochar0.031250
unamended0.031250
clear day0.031250
dust storm0.031250
diarrhea0.031250
milk allergy0.031250
sesame allergy0.031250
antibiotic0.031250
salt0.031250
salt rich diet0.031250
fructose diet0.031250
fructose0.031250
clay soil0.020833
loam0.020833
loam soil0.020833
loamy sand soil0.020833
surface0.020833
fruit0.020833
cucumis sativus0.020833
cucumber0.020833
ph 7.30.020833
ph 6.50.020833
pancreatic cancer0.020833
first trimester0.020833
third trimester0.020833
nectar0.020833
flower0.020833
LOWER IN control diet0.020833
fermented corn0.020833
LOWER IN fresh corn0.020833
ampicillin0.020833
neomycin0.020833
LOWER IN wastewater treatment plant0.010417
LOWER IN treated wastewater0.010417
LOWER IN drinking water0.010417
LOWER IN tap water0.010417
dry0.010417
LOWER IN irrigated0.010417
LOWER IN dry0.010417
LOWER IN pancreatic cancer0.010417
amended with biochar0.010417
LOWER IN unamended0.010417
LOWER IN amended with biochar0.010417
LOWER IN clear day0.010417
Exp. ID User ID Description Date Region Flag Sequences
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in feces homo sapiens pathogen israel )2017-10-05v4No1 / 1
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
831amnon high in control compared to pancreatic cancer in feces homo sapiens adult israel 2021-09-11v3No1 / 5
306amnonincreases after 90 days of fermentation of insiled whole plant corn ( high in fermented corn days 90 compared to fresh corn day 0 in zea mays subsp. mays whole plant israel corn )2018-03-19v4No1 / 5
662amnondominant water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 6
263amnonhigh freq. in desert soil irrigated daily in lab (dominant research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 7
56amnondominant nectar, israel, flower, nicotiana glauca2017-01-30v4No1 / 8
769sheryodominant in no tillage wheat field in northern israel (dominant soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 9
306amnonhigh freq. at whole plant corn at time 0 (dominant zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 9
662amnondominant soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-22v3No1 / 10
769sheryoDominant in conventional tillage wheat field in northern israel (dominant soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 10
662amnondominant soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 11
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 12
587amnondominant israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 12
662amnondominant soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 14
602sheryocommon in rhizoshere of tomato plant roots planted in potting mix amended with biochar (common rhizosphere, solanum lycopersicum, israel, biochar, potting mix, ph 7.3)2020-04-03v4No1 / 14
602sheryocommon soil, rhizosphere, solanum lycopersicum, israel, biochar2020-04-03v4No1 / 14
602sheryodominant in rhizoshere of tomato plant roots planted in potting mix amended with biochar (dominant rhizosphere, solanum lycopersicum, israel, biochar, potting mix, ph 7.3)2020-04-05v4No1 / 14
831amnondominant feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 14
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
587amnondominant israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 15
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
662amnondominant water, drinking water, tap water, israel2020-09-20v3No1 / 17
602sheryocommon in rhizoshere of tomato plant roots planted in unamended potting mix (common rhizosphere, solanum lycopersicum, israel, ph 6.5, unamended, potting mix)2020-04-03v4No1 / 17
602sheryodominant in rhizoshere of tomato plant roots planted in unamended potting mix (dominant rhizosphere, solanum lycopersicum, israel, ph 6.5, unamended, potting mix)2020-04-03v4No1 / 17
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
662amnondominant in cucumber surface (dominant surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 19
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays whole plant israel corn )2018-03-19v4No1 / 19
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 20
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
334amnondominant feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 22
587amnondominant israel, food product type, medicago sativa, alfalfa sprouts, producer c22020-02-10v3No1 / 23
587amnondominant israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 23
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 36
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays whole plant israel corn )2018-03-19v4No1 / 45
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 47
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
769sheryoHigh in no tillage compared to conventional tillage in wheat field in northern israel ( high in no tillage compared to conventional tillage in soil bulk soil triticum aestivum israel vertisol northen israel )2021-04-18v4No1 / 65
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
662amnoncommon water, drinking water, tap water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to wastewater treatment plant treated wastewater in water israel 2020-09-20v3No1 / 89
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in soil bulk soil triticum aestivum israel vertisol northen israel )2021-04-18v4No1 / 91
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 96
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 106
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 127
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 130
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in fertilized water irrigation treated wastewater irrigation tapwater irrigation compared to artificial wastewater irrigation in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 134
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 145
662amnon high in irrigated compared to dry in soil israel depth (soil) 0-10cm agricultural field neve yaar 2020-09-21v3No1 / 146
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 153
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
334amnoncommon feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 200
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c22020-02-10v3No1 / 215
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in rhizosphere solanum lycopersicum israel potting mix )2020-04-05v4No1 / 252
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in rhizosphere solanum lycopersicum israel potting mix )2020-04-05v4No1 / 270
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 284
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 402
206amnonhigher in dust storm compared to clear days in israel air ( high in dust storm compared to clear day in air dust israel size < 10um )2017-10-04v4No1 / 411
662amnoncommon water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 473
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-21v3No1 / 489
662amnon high in wastewater treatment plant treated wastewater compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
662amnon high in dry compared to irrigated in soil israel depth (soil) 0-10cm agricultural field neve yaar 2020-09-21v3No1 / 782
769sheryocommon in conventional tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, conventional tillage, northen israel)2021-04-18v4No1 / 861
769sheryocommon in no tillage wheat field in northern israel (common soil, bulk soil, triticum aestivum, israel, vertisol, northen israel, no tillage)2021-04-18v4No1 / 871
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
263amnoncommon in desert soil irrigated daily in lab (common research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 1076
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893

Problems / suggestions? Please email info AT dbbact DOT org