Summary for ontology term: italy

Number of annotations with term: 143

Top positive-associated sequence

Taxonomy Sequence Recall
TTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTGTGGCGTACGGTGTGTTCCGGGCACTTGTTGTCTGAGTAACCTGCTGTTGCCATCCTTGGGTGGAACCTGTGTGGCATTAGGTTGTCGTGC0.006993
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGAATTACTGGGTTTAAAGGGTGCGTAGGCGGGTTAATAAGTCAGAAGTGAAAGCATTATGCTCAACATGATAATTGCTTTTGATACTGTTAATCTTGAATTAGGACGAGGCTGGCGGAATGTGGCA0.006993
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.006993
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__"Saprospiraceae"TACGGAGGGTGCAAGCGTTATCCGGAATCACTGGGTTTAAAGGGTGCGTAGGCGGTGCTATAAGTCAGAGGTGAAAGCTTGCAGCTTAACTGTGAAACTGCCTTTGATACTGTAGCACTTGAATTAGGTTGAGGTTAGCGGAATGAGTCA0.006993
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTCAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.006993
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.006993
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTCAAATAAGTCAACTGTTAAATCTTGAGGCTCAACCTCGAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAG0.006993
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.006993
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACTGCATTTGAAACTGGCAAACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG0.006993
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Pseudoalteromonadaceae;g__PsychrosphaeraTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGTCATTTAAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGATGACTAGAGTGCGACAGAGGGTGGTAGAATTTCAGG0.006993

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACGGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTCCAAAACTCCCAGTCTTGAGTTCGAGAGAGGTGAGTGGAACTCCGAG0.500000
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeCACGTACTGTGCGAACGTTATTCGGAATCACTGGGCTTAAAGGGTATGTAGGCGGTTAATCAAGTCAGATGTGAAATGCCACAGCTCAACTGTGGCACTGCGTTTGAAACTGATTGGCTAGAGTATTCCAGAGGTATGCGGAACTGCCAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Cryomorphaceae;g__CrocinitomixTACGGAGGGTCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTTCGCAGGCGGTCAATTAAGTCAGTGGTGAAATCTCGGGGCTCAACTCCGAAACTGCCATTGATACTGATTGACTTGAATTAAGTTGGAGTAGGCGGAATGTGTAG0.500000
d__BacteriaGACAGAGGGTGCGAACGTTGCTCGGAATCACTGGGCGTAAAGCGCGTGTAGGCGGACTGATAAGTCGGGTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGCCAGTCTTGAGTGTCGGAGAGGGAAGTGGAATTGCTGG0.500000
d__BacteriaTACGAGGGGTGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGCGGGTGTAGGTGGTCATATAAGTCAGAAGTGAAAGCCCAGGGCTCAACCTTGGAAGTGCTTTTGATACTGTATGACTTGAGTGTAAGAGAGGTTACTAGAATTCCTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__"Rhodothermaceae";g__RubricoccusTACGGAGGGTCCAAGCGTTGTCCGGAATCACTGGGTGTAAAGGGTGCGTAGGCGGGCGTGTAAGTCAGGGGTGAAAGCCACCGGCCTAACCGGTGAACTGCCCTTGATACTGCACGTCTTGAGTCCTGGAGAGGCTATCGGAATTCGTGG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGAATTACTGGGTTTAAAGGGTGCGTAGGCGGCTATATAAGTCAGGAGTGAAAGGTTCCCGCTAAACGGGAGACGGTCTTTTGATACTGTATAGCTTGAATAAGGTTGAGGTTAGCGGAATGTGACA0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCAACAAGTCGGTCGTGAAAGTTCAGGGCTCAACCCTGAAATGTCGATCGATACTGTTGTGACTAGGATACGGTAGAGGTGAGTGGAATTCCGA0.500000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family II;g__GpIIaTACGGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGCAGGCGGCCCTTCAAGTCTGCTGTTAAAAAGTGGAGCTTAACTCCATCATGGCAGTGGAAACTGTTGGGCTTGAGTGTGGTAGGGGCAGAGGGAATTCCCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.215983
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCCTCAAGGAAGATAATGACGGTACTTGAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.200409
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGGGGAAGATAATGACGGTACCCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.193980
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGACGCCGCGTGGGGGAATGAAGGTCTTCGGATTGTAAACCCCTGTCATGTGGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCC0.175732
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.172702
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTTGACTGGGAGCAAGCCCTTCGGGGTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGCA0.169492
d__BacteriaTGGGGAATATTGGGCAATGGGCGAAAGCCTGACCCAGCGACGCCGCGTGAGGGAAGAAGATCTTCGGATTGTAAACCTTAGTCAACAGGGAAGAAGAAAGTGACGGTACCTGTGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.169312
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTGGGGAATATTGGGCAATGGACGCAAGTCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGCTTTCGGGTTGTAAACTTCTTTTGTCAGGGAAGAGTAGAAGACGGTACCTGACGAATAAGCCACGGCTAACTACGTGCCAGCAGCCGCGG0.168142
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGAGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.166008
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.162791

Annotations:

common ontology terms
term enrichment score
TermScore
italy1.020709
ceratitis capitata0.133333
mediterranean fruit fly0.133333
gestational diabetes0.130719
orchard0.103226
milan0.103226
dairy0.100629
milk0.100629
cow milk (fluid)0.100629
cow milk (raw)0.100629
ovis aries0.098522
age 30 days0.095808
dog0.091047
canis lupus familiaris0.087083
whole body0.086957
body proper0.083333
apennine mountains0.077419
prunus armeniaca0.077419
apricot0.077419
depth (soil) 10 cm0.074534
obsolete_juvenile stage0.071749
larval stage0.070671
turin township0.067568
feces0.066408
mediterranean sea0.065359
lowland pasture0.065359
lowland farm0.065359
human adult stage0.063636
farm0.061920
homo sapiens0.058485
2-5 year-old child stage0.057416
adult0.055006
european hare0.053691
lama guanicoe0.052980
lepus europaeus0.052980
equus asinus africanus0.051613
omasum0.050314
pregnancy0.049261
rectal swab0.049080
saliva0.042705
before hsct0.040268
after hcst0.040268
hematopoietic stem cell transplant0.040268
lymphoma0.040268
rattus rattus0.040268
alpine0.040268
alpine pasture0.040268
litter bag0.040268
sigmoid colon brushing0.040268
third trimester0.040268
colon0.039474
hay0.039474
plant litter0.039474
autistic disorder0.039474
colonic mucosa0.039474
obesity0.039088
ruminant reticulum0.038710
sigmoid colon0.038710
high bmi0.036923
rectum0.034091
child0.033426
depth (soil) 0-20cm0.031332
rat0.030457
ph 7-80.030000
rumen0.029557
bologna0.027586
gulf of naples0.027211
apodemus sylvaticus0.027211
wood mouse0.027211
short beaked common dolphin0.027211
african wild ass0.027211
equus ferus0.027211
felis silvestris0.027211
wild cat0.027211
hexaprotodon liberiensis0.027211
pygmy hippopotamus0.027211
hippopotamus amphibius0.027211
ovis aries musimon0.027211
mouflon0.027211
panthera tigris0.027211
tiger0.027211
sus scrofa domesticus0.027211
tapirus terrestris0.027211
south american tapir0.027211
common bottlenose dolphin0.027211
vicugna pacos0.027211
alpaca0.027211
annona cherimola0.027211
non-celiac gluten sensitivity0.027211
citrus sinensis0.027211
orange0.027211
ficus carica0.027211
fig0.027211
prickly pear0.027211
opuntia ficus indica0.027211
prunus persica0.027211
peach0.027211
adriatic sea coastal waters of italy0.027211
caretta caretta0.027211
loggerhead sea turtle0.027211
Fraction of dbbact annotations with this term covered by the query
TermScore
italy1.050000
spring1.000000
LOWER IN spring1.000000
pupa1.000000
gestational diabetes1.000000
turin township1.000000
bologna1.000000
orchard0.666667
european hare0.666667
milan0.666667
apennine mountains0.500000
prunus armeniaca0.500000
apricot0.500000
dairy0.500000
before hsct0.500000
LOWER IN after hcst0.500000
LOWER IN hematopoietic stem cell transplant0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
mediterranean sea0.500000
gulf of naples0.500000
apodemus sylvaticus0.500000
wood mouse0.500000
LOWER IN lymphoma0.500000
short beaked common dolphin0.500000
lymphoma0.500000
african wild ass0.500000
equus ferus0.500000
felis silvestris0.500000
wild cat0.500000
hexaprotodon liberiensis0.500000
pygmy hippopotamus0.500000
hippopotamus amphibius0.500000
lama guanicoe0.500000
lepus europaeus0.500000
ovis aries musimon0.500000
mouflon0.500000
panthera tigris0.500000
tiger0.500000
rattus rattus0.500000
sus scrofa domesticus0.500000
tapirus terrestris0.500000
south american tapir0.500000
common bottlenose dolphin0.500000
vicugna pacos0.500000
alpaca0.500000
alpine0.500000
alpine pasture0.500000
LOWER IN lowland pasture0.500000
LOWER IN lowland farm0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
lowland pasture0.500000
lowland farm0.500000
LOWER IN alpine0.500000
LOWER IN alpine pasture0.500000
june0.500000
LOWER IN october0.500000
october0.500000
LOWER IN june0.500000
litter bag0.500000
ceratitis capitata0.500000
annona cherimola0.500000
mediterranean fruit fly0.500000
non-celiac gluten sensitivity0.500000
citrus sinensis0.500000
orange0.500000
ficus carica0.500000
fig0.500000
prickly pear0.500000
opuntia ficus indica0.500000
prunus persica0.500000
peach0.500000
yogurt food product0.500000
LOWER IN sigmoid colon brushing0.500000
sigmoid colon brushing0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
third trimester0.500000
harbor0.500000
clavelina oblonga0.500000
sea squirts0.500000
inner tunic0.500000
LOWER IN litter bag0.500000
depth (soil) 10 cm0.333333
age 30 days0.333333
colon0.333333
LOWER IN colon0.333333
depth (water) 0-100cm0.333333
delphinus delphis0.333333
equus asinus africanus0.333333
equus asinus0.333333
donkey0.333333
wild horse0.333333
european rabbit0.333333
wild boar0.333333
tursiops truncatus0.333333
Fraction of annotations for the query sequences containing the term
TermScore
italy0.993007
feces0.636364
homo sapiens0.244755
adult0.132867
body proper0.076923
ceratitis capitata0.076923
whole body0.076923
mediterranean fruit fly0.076923
ovis aries0.069930
canis lupus familiaris0.069930
dog0.069930
farm0.069930
larval stage0.069930
gestational diabetes0.069930
orchard0.055944
dairy0.055944
obsolete_juvenile stage0.055944
age 30 days0.055944
milk0.055944
cow milk (fluid)0.055944
cow milk (raw)0.055944
milan0.055944
control0.048951
human adult stage0.048951
apennine mountains0.041958
prunus armeniaca0.041958
apricot0.041958
depth (soil) 0-20cm0.041958
depth (soil) 10 cm0.041958
saliva0.041958
child0.041958
2-5 year-old child stage0.041958
soil0.034965
mediterranean sea0.034965
lowland pasture0.034965
lowland farm0.034965
female0.034965
pregnancy0.034965
turin township0.034965
omasum0.027972
rectal swab0.027972
equus asinus africanus0.027972
lama guanicoe0.027972
lepus europaeus0.027972
european hare0.027972
ph 7-80.020979
ruminant reticulum0.020979
rumen0.020979
rectum0.020979
caecum0.020979
colon0.020979
before hsct0.020979
after hcst0.020979
hematopoietic stem cell transplant0.020979
high bmi0.020979
obesity0.020979
LOWER IN control0.020979
lymphoma0.020979
rat0.020979
rattus rattus0.020979
alpine0.020979
alpine pasture0.020979
hay0.020979
plant litter0.020979
litter bag0.020979
autistic disorder0.020979
colonic mucosa0.020979
sigmoid colon0.020979
sigmoid colon brushing0.020979
third trimester0.020979
rhizosphere0.013986
citrus0.013986
cultivated environment0.013986
coast0.013986
water0.013986
saline water0.013986
surface water0.013986
sea water0.013986
gulf of naples0.013986
depth (water) 0-100cm0.013986
depth (water) 20-100cm0.013986
apodemus sylvaticus0.013986
wood mouse0.013986
bos taurus0.013986
cow0.013986
wild0.013986
canis lupus0.013986
wolf0.013986
capra hircus0.013986
goat0.013986
delphinus delphis0.013986
short beaked common dolphin0.013986
african wild ass0.013986
equus asinus0.013986
donkey0.013986
equus ferus0.013986
wild horse0.013986
equus caballus0.013986
horse0.013986
felis silvestris0.013986
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant feces, italy, rat, rattus rattus2020-09-25v3No1 / 1
363amnondominant dairy, omasum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 2
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 2
348amnondominant italy, yogurt food product, food (fermented)2018-07-16v4No1 / 2
798amnondominant orchard, soil, italy, ph 7-8, apennine mountains, prunus armeniaca, apricot, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 3
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
415amnondominant orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 4
655amnon high in before hsct compared to after hcst hematopoietic stem cell transplant in feces homo sapiens italy 2020-09-13v3No1 / 4
617amnon high in june spring compared to autumn october in farm milk italy cow milk (fluid) cow milk (raw) lowland pasture lowland farm 2020-05-03v3No1 / 4
666amnondominant feces, bos taurus, italy, cow2020-09-25v3No1 / 5
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
346amnonhigh freq. in fruitfly larva grown on peach (dominant larval stage, body proper, prunus persica, ceratitis capitata, italy, whole body, peach, mediterranean fruit fly)2018-06-11v4No1 / 6
666amnondominant feces, ovis aries, italy, sheep2020-09-25v3No1 / 7
666amnondominant feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 7
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 7
666amnoncommon feces, italy, lama guanicoe, lepus europaeus, european hare2020-09-25v3No1 / 8
666amnondominant feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 8
346amnonhigh freq. in fruitfly larva grown on orange (dominant larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on prickly pear (dominant larval stage, body proper, ceratitis capitata, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly)2018-06-11v4No1 / 8
666amnondominant feces, italy, capra hircus, goat2020-09-25v3No1 / 9
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
666amnondominant feces, equus caballus, italy, horse2020-09-25v3No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, ceratitis capitata, italy, whole body, orange, mediterranean fruit fly)2018-06-11v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (dominant larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 10
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 11
666amnondominant feces, italy, equus ferus, wild horse2020-09-25v3No1 / 12
798amnondominant orchard, hay, italy, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 12
666amnondominant feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 13
666amnondominant feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 13
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
666amnondominant feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 13
666amnondominant feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 14
666amnondominant feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 14
666amnondominant feces, italy, rat, rattus rattus2020-09-25v3No1 / 14
617amnon high in autumn october compared to june spring in farm milk italy cow milk (fluid) cow milk (raw) lowland pasture lowland farm 2020-05-03v3No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
655amnon high in after hcst hematopoietic stem cell transplant compared to before hsct in feces homo sapiens italy 2020-09-13v3No1 / 15
666amnondominant feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, ceratitis capitata, italy, whole body, ficus carica, fig, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, ceratitis capitata, italy, whole body, peach, mediterranean fruit fly)2018-06-11v4No1 / 15
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
743amnondominant feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 17
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 17
363amnondominant dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
666amnondominant feces, italy, lama guanicoe2020-09-25v3No1 / 18
666amnondominant feces, oryctolagus cuniculus, italy, european rabbit2020-09-25v3No1 / 18
666amnondominant feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 18
666amnondominant feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
666amnondominant feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 19
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 19
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
851amnondominant feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 20
881amnondominant feces, canis lupus familiaris, italy, dog, adult organism, bologna2022-03-12v3No1 / 20
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
666amnondominant feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v3No1 / 21
726amnondominant homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 21
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
666amnondominant feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 22
666amnondominant feces, italy, lama guanicoe, lepus europaeus, european hare2020-09-25v3No1 / 22
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
485amnondominant coast, water, saline water, surface water, sea water, mediterranean sea, italy, gulf of naples, depth (water) 0-100cm, depth (water) 20-100cm2019-02-19v4No1 / 23
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, ceratitis capitata, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly)2018-06-11v4No1 / 23
346amnonhigher in pupae compared to larva and adult in fruit fly ( high in pupa compared to larval stage larva adult in body proper ceratitis capitata italy whole body mediterranean fruit fly )2018-06-11v4No1 / 23
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 24
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
881amnoncommon feces, canis lupus familiaris, italy, dog, adult organism, bologna2022-03-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 52
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
851amnoncommon feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 62
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 85
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
851amnon high in feces compared to colonic mucosa sigmoid colon sigmoid colon brushing in homo sapiens adult italy milan 2021-12-16v3No1 / 132
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine alpine pasture compared to lowland pasture lowland farm in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 204
699amnon high in kingdom of spain mediterranean sea italy compared to united states of america atlantic ocean brazil in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 216
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
485amnoncommon coast, water, saline water, surface water, sea water, mediterranean sea, italy, gulf of naples, depth (water) 0-100cm, depth (water) 20-100cm2019-02-19v4No1 / 244
666amnoncommon feces, oryctolagus cuniculus, italy, european rabbit2020-09-25v3No1 / 252
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
363amnoncommon dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 302
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
699amnon high in united states of america atlantic ocean brazil compared to kingdom of spain mediterranean sea italy in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 317
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
363amnon high in ruminant reticulum omasum rumen compared to rectum caecum colon in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 360
798amnon high in hay plant litter litter bag compared to soil ph 7-8 in orchard italy apennine mountains prunus armeniaca apricot depth (soil) 0-20cm depth (soil) 10 cm 2021-06-13v3No1 / 377
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
666amnoncommon feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 450
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
798amnoncommon orchard, hay, italy, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 508
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
666amnoncommon feces, italy, equus ferus, wild horse2020-09-25v3No1 / 715
798amnoncommon orchard, soil, italy, ph 7-8, apennine mountains, prunus armeniaca, apricot, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 1230
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy apennine mountains prunus armeniaca apricot depth (soil) 0-20cm depth (soil) 10 cm 2021-06-13v3No1 / 1285

Problems / suggestions? Please email info AT dbbact DOT org