Summary for ontology term: jackson laboratories

Number of annotations with term: 40

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGGAGCAAGTCTGATGTGAAAATCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGTTTATCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTACGGCAAGTCAGAAGTGAAAGCCTGGGGCTCAACCCCGGAATTGCTTTTGAAACTGTCGAACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.138889
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTGTCAAGTCAGCGGTAAAATTGAGAGGCTCAACCTCTTCCCGCCGTTGAAACTGGTGGTCTTGAGTGGATGAGAAGTACGCGGAATGCGTGGT0.138889
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGCAGGCGGCGCGCCAAGTCTGATGTGAAACCCCGGGGCTCAACCCCGGGCATGCATTGGAAACTGGCGGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGTAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCAAGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAAGACAAGTCAGATGTGAAATCCCGCGGCTCAACCGCGGAACTGCATTTGAAACTGTTTTTCTTGAGTACCGGAGAGGTCATCGGAATTCCTTG0.138889
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCAAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGGAACTGTGCGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.138889
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGATGTGCAAGTCAGTCGTGAAATACCGGGGCTCAACCCCGGGGCTGCGATTGAAACTGCACACCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.138889

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCTTTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAAAGCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCTGTGCAAGTCTGGAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTCTGGAAACTGTAAAGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGAAAGTCTGAAGTGAAAGCCCGCGGCTCAACCGCGGAATGGCTTTGGAAACTTTTTTGCTGGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.833333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__LactobacillaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.833333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTAATTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGTTGACTTGAGTATATTTGAGGTAGGCGGAATGCGTGG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGCAGGCGGCTCTGCAAGTCAGGCGTGAAAGCTAGGGGCTCAACCCCTAAACTGCGCTTGAAACTGTGGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCAGACAAGTCTGAAGTGAAAATCCAGCGCTTAACGTTGGAAGTGCTTTGGAAACTGCCGGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTAG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTAGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.833333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCGATGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTGTTGCTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.833333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGGAGCAAGTCTGATGTGAAAATCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGTTTATCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.417910
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCCGGAGTGAAAGCCCGGGGCTCAACCCTGGGACTGCTCTGGAAACTGCAAAGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.384615
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGCCTTGCAAGTCAGGCGTGAAAACCATGGGCTCAACCCGTGGACTGCGTTTGAAACTGTGAGGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.367816
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.367347
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAGGTCGGGGCCCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.363636
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTTAACCTGGGAACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.354430
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGGAATTAAGTTAGTTGTGAAATCCCAAGGCTCAACTTTGGAACTGCAACTAAAACTAATTTTCTTGAGTACTGGAGAGGAAAGTGGAATTCCTAG0.352941
d__BacteriaTACATAGGGAGCAAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGACGGAGGAACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTCCCCTTGAGTGTCGGAGAGGAAAGTGGAATTCCTAG0.350000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCAATGCAAGTCAGGCGTGAAAGCTCGGGGCTTAACCCCGAAACTGCGCTTGAAACTGTGTTGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.349206
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCGATCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGAAACTGGTGGGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.345679

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
jackson laboratories1.000000
high fat diet + inulin0.500000
harlan sprague dawley0.500000
LOWER IN jackson laboratories0.500000
LOWER IN harlan spague dawley0.500000
LOWER IN high fat diet + inulin0.500000
LOWER IN taconic farms0.500000
strain 129s0.500000
taconic farms0.500000
LOWER IN strain 129s0.500000
strain s1290.500000
LOWER IN strain s1290.500000
LOWER IN low fat diet0.333333
low fat diet0.333333
LOWER IN starch diet0.333333
state of utah0.333333
starch diet0.333333
LOWER IN colon0.333333
colon0.333333
c57bl/6j0.300000
age 2 months0.250000
age 8 weeks0.250000
LOWER IN terminal ileum0.250000
terminal ileum0.250000
LOWER IN right colon0.200000
right colon0.200000
high fat diet0.166667
mouse chow0.133333
state of georgia0.125000
c57bl/60.111111
mouse0.105263
LOWER IN c57bl/6j0.100000
mus musculus0.095238
LOWER IN high fat diet0.083333
LOWER IN mouse chow0.066667
LOWER IN ileum0.062500
ileum0.062500
research facility0.040816
canada0.040000
female0.031746
united states of america0.020243
feces0.019108
LOWER IN feces0.003185
glucose diet0.000000
LOWER IN glucose diet0.000000
Fraction of annotations for the query sequences containing the term
TermScore
research facility1.000000
mus musculus1.000000
mouse1.000000
jackson laboratories0.875000
feces0.750000
c57bl/60.650000
united states of america0.600000
canada0.400000
age 8 weeks0.400000
state of georgia0.250000
mouse chow0.150000
female0.150000
c57bl/6j0.150000
high fat diet0.125000
LOWER IN jackson laboratories0.125000
colon0.125000
right colon0.125000
ileum0.125000
terminal ileum0.125000
low fat diet0.100000
LOWER IN taconic farms0.100000
taconic farms0.100000
high fat diet + inulin0.075000
strain 129s0.075000
LOWER IN low fat diet0.050000
LOWER IN mouse chow0.050000
state of utah0.050000
age 2 months0.050000
LOWER IN c57bl/6j0.050000
LOWER IN feces0.050000
LOWER IN high fat diet0.025000
harlan sprague dawley0.025000
LOWER IN harlan spague dawley0.025000
LOWER IN high fat diet + inulin0.025000
glucose diet0.025000
LOWER IN starch diet0.025000
starch diet0.025000
LOWER IN glucose diet0.025000
LOWER IN strain 129s0.025000
strain s1290.025000
LOWER IN strain s1290.025000
LOWER IN colon0.025000
LOWER IN right colon0.025000
LOWER IN ileum0.025000
LOWER IN terminal ileum0.025000
Exp. ID User ID Description Date Region Flag Sequences
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 12
441amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 13
458amnonhigh freq. in mice strains from jackson laboratories (dominant feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 14
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 18
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 22
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
896amnon high in starch diet compared to glucose diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 70
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
441amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 99
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 108
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
458amnoncommon in mice strains from jackson laboratories (common feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 129
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 140
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 154
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 186
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 207
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
896amnon high in glucose diet compared to starch diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 238
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644

Problems / suggestions? Please email info AT dbbact DOT org