Summary for ontology term: japan

Number of annotations with term: 99

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGAGGAAACTCTGAACCAGCCATGCCGCGTGAAGGATGACGGCCCTATGGGTTGTAAACTTCTTTTATATGGGAAGAAACTTATCTACGTGTAGATAACTGACGGTACCATACGAATAAGGATCGGCTAACT0.180180
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGTCAATGGAGGCAACTCTGAACCAGCCATGCCGCGTGAAGGATGACGGCCCTATGGGTTGTAAACTTCTTTTATATGGGAAGAAACTTATCTACGTGTAGATAACTGACGGTACCATACGAATAAGGATCGGCTAACT0.180180
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTGGGGAATCTTAGACAATGGGGGCAACCCTGATCTAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTCGTAAAGCTCTTTCGCCTGTGATGATAATGACAGTAGCAGGTAAAGAAACCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.180180
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGAGGCCACTCTGATCCAGCCATGCCGCGTGCAGGAAGACTGCCCTATGGGTTGTAAACTGCTTTTATACAGGAAGAAACTGCGCTACGAGTAGCGTACTGACGGTACTGTAAGAATAAGGATCGGCTAACT0.146789
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGTCGAAAGACTGATCCAGCCATGCCGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATACGGGAAGAAAAACACCTACGTGTAGGTGACTGACGGTACCGTAAGAATAAGGACCGGCTAACT0.145455
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family II;g__GpIIaTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAGATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGG0.144000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGTCAGCTGTGAAAGTCCGCGGCTCAACCGTGGAATTGCAGTTGAAACTGGAGGCCTTGAGTGCACACAGGGATGCCGGAATTCATGG0.134228
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGC0.132353
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesGATGAACGCTAGCTACAGGCTTAACACATGCAAGTCGAGGGGCAGCATGGTCTTAGCTTGCTAAGGCCGATGGCGACCGGCGCACGGGTGAGTAACACGTATCCAACCTGCCGTCTACTCTTGGACAGCCTTCTGAAAGGAAGATTAATA0.131387
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAACTCTTTCGTCAGGGAAGATAATGACGGTACCTGAAGAAGAAGATCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.129630

Annotations:

common ontology terms
term enrichment score
TermScore
japan1.028571
hokkaido0.260163
okinawa islands0.220472
near shore0.198582
filtered 0.2um0.153005
normal weather0.139130
starfish0.139130
tonsillectomy0.139130
coelomic fluid0.130081
balb/c0.122137
palatine tonsil0.115108
andrias japonicus0.108108
japanese giant salamander0.108108
surface water0.104869
mountain0.102564
snow field0.097561
human early adulthood stage0.095808
c57bl/60.095238
80 year-old and over human stage0.091743
wild0.087336
sea water0.085106
summer0.082051
ph 5.40.074766
asterias amurensis0.074766
patiria pectinifera0.074766
autumn0.073684
mus musculus0.072611
ninth decade human stage0.072072
city0.066116
skin0.064220
topsoil0.059259
forest ecosystem0.059259
centenarian human stage0.057143
eleventh decade human stage0.057143
non-pregnant0.057143
depth 6-7m0.057143
tropical storm0.057143
storm0.057143
typhoon0.057143
stress0.057143
recurrent tonsillitis0.057143
adult0.056000
third trimester0.055556
depth 1-2m0.055556
iga glomerulonephritis0.055556
tonsillitis0.054054
depth (soil) 0-10cm0.052980
research facility0.044234
pregnancy0.043478
malaria0.038835
LOWER IN malaria0.038835
mikura-jima0.038835
LOWER IN normal weather0.038835
tcr-alpha knockout0.038835
LOWER IN stress0.038835
lithobates catesbeianus0.038835
LOWER IN starfish0.038835
LOWER IN patiria pectinifera0.038835
LOWER IN asterias amurensis0.038835
physopelta0.038835
feces0.038377
LOWER IN ninth decade human stage0.038095
bottlenosed dolphin0.038095
rana catesbeiana0.038095
bullfrog0.038095
LOWER IN coelomic fluid0.038095
tursiops truncatus0.037383
midgut0.036697
late time points0.034783
LOWER IN early time points0.034783
early time points0.034783
LOWER IN late time points0.034783
frog0.034783
sprague dawley0.033613
LOWER IN summer0.032520
air0.032000
saliva0.031496
rattus norvegicus0.031496
oral cavity0.031008
rat0.029630
mouse0.028209
pacific ocean0.026490
LOWER IN wild0.026490
homo sapiens0.025723
female0.024242
LOWER IN control0.024058
LOWER IN sea water0.023392
control0.022706
LOWER IN eleventh decade human stage0.019802
LOWER IN centenarian human stage0.019802
LOWER IN 80 year-old and over human stage0.019802
LOWER IN non-pregnant0.019802
experimental cerebral malaria0.019802
LOWER IN experimental cerebral malaria0.019802
LOWER IN tropical storm0.019802
LOWER IN depth 6-7m0.019802
LOWER IN storm0.019802
LOWER IN typhoon0.019802
LOWER IN snow covered soil0.019802
non snow covered soil0.019802
Fraction of dbbact annotations with this term covered by the query
TermScore
japan1.058824
hokkaido0.666667
80 year-old and over human stage0.500000
centenarian human stage0.500000
eleventh decade human stage0.500000
LOWER IN eleventh decade human stage0.500000
LOWER IN centenarian human stage0.500000
LOWER IN 80 year-old and over human stage0.500000
non-pregnant0.500000
LOWER IN non-pregnant0.500000
experimental cerebral malaria0.500000
malaria0.500000
LOWER IN experimental cerebral malaria0.500000
LOWER IN malaria0.500000
mikura-jima0.500000
okinawa islands0.500000
LOWER IN tropical storm0.500000
normal weather0.500000
depth 6-7m0.500000
LOWER IN depth 6-7m0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
LOWER IN storm0.500000
LOWER IN typhoon0.500000
storm0.500000
typhoon0.500000
tcr-alpha knockout0.500000
stress0.500000
LOWER IN stress0.500000
ph 5.40.500000
LOWER IN snow covered soil0.500000
non snow covered soil0.500000
snow covered soil0.500000
LOWER IN non snow covered soil0.500000
lithobates catesbeianus0.500000
starfish0.500000
asterias amurensis0.500000
patiria pectinifera0.500000
LOWER IN starfish0.500000
LOWER IN patiria pectinifera0.500000
LOWER IN asterias amurensis0.500000
physopelta0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
zoo0.500000
LOWER IN area designated as a nature reserve0.500000
LOWER IN zoo0.500000
area designated as a nature reserve0.500000
LOWER IN recurrent tonsillitis0.500000
tonsillectomy0.500000
recurrent tonsillitis0.500000
LOWER IN ninth decade human stage0.333333
ninth decade human stage0.333333
25-44 year-old human stage0.333333
LOWER IN 25-44 year-old human stage0.333333
LOWER IN third trimester0.333333
third trimester0.333333
bottlenosed dolphin0.333333
near shore0.333333
mountain0.333333
depth 1-2m0.333333
LOWER IN depth 1-2m0.333333
rana catesbeiana0.333333
bullfrog0.333333
coelomic fluid0.333333
LOWER IN coelomic fluid0.333333
LOWER IN amphibian larval stage0.333333
amphibian larval stage0.333333
iga glomerulonephritis0.333333
LOWER IN iga glomerulonephritis0.333333
balb/c0.250000
tursiops truncatus0.250000
snow field0.250000
LOWER IN snow0.250000
snow0.250000
LOWER IN tonsillitis0.250000
tonsillitis0.250000
midgut0.200000
LOWER IN pond water0.200000
pond water0.200000
palatine tonsil0.200000
filtered 0.2um0.166667
LOWER IN tadpole0.166667
tadpole0.166667
late time points0.125000
LOWER IN early time points0.125000
early time points0.125000
LOWER IN late time points0.125000
LOWER IN balb/c0.125000
frog0.125000
human early adulthood stage0.117647
topsoil0.111111
forest ecosystem0.111111
LOWER IN pond0.111111
pond0.111111
LOWER IN iga positive fraction0.111111
iga negative fraction0.111111
LOWER IN iga negative fraction0.111111
iga positive fraction0.111111
c57bl/60.100000
Fraction of annotations for the query sequences containing the term
TermScore
japan1.000000
feces0.353535
adult0.212121
research facility0.212121
mus musculus0.191919
homo sapiens0.181818
sea water0.181818
hokkaido0.161616
okinawa islands0.141414
filtered 0.2um0.141414
near shore0.141414
surface water0.141414
city0.121212
mouse0.101010
wild0.101010
c57bl/60.090909
human early adulthood stage0.080808
balb/c0.080808
summer0.080808
normal weather0.080808
starfish0.080808
coelomic fluid0.080808
tonsillectomy0.080808
palatine tonsil0.080808
autumn0.070707
skin0.070707
female0.060606
saliva0.060606
snow field0.060606
mountain0.060606
andrias japonicus0.060606
japanese giant salamander0.060606
80 year-old and over human stage0.050505
LOWER IN control0.050505
ninth decade human stage0.040404
control0.040404
soil0.040404
depth (soil) 0-10cm0.040404
topsoil0.040404
ph 5.40.040404
forest ecosystem0.040404
asterias amurensis0.040404
patiria pectinifera0.040404
centenarian human stage0.030303
eleventh decade human stage0.030303
non-pregnant0.030303
third trimester0.030303
pregnancy0.030303
depth 6-7m0.030303
depth 1-2m0.030303
tropical storm0.030303
storm0.030303
typhoon0.030303
stress0.030303
iga glomerulonephritis0.030303
recurrent tonsillitis0.030303
tonsillitis0.030303
LOWER IN ninth decade human stage0.020202
late time points0.020202
LOWER IN early time points0.020202
malaria0.020202
early time points0.020202
LOWER IN late time points0.020202
LOWER IN malaria0.020202
pacific ocean0.020202
mikura-jima0.020202
bottlenosed dolphin0.020202
tursiops truncatus0.020202
oral cavity0.020202
sprague dawley0.020202
rattus norvegicus0.020202
rat0.020202
LOWER IN normal weather0.020202
LOWER IN summer0.020202
tcr-alpha knockout0.020202
LOWER IN stress0.020202
rana catesbeiana0.020202
bullfrog0.020202
lithobates catesbeianus0.020202
frog0.020202
LOWER IN sea water0.020202
LOWER IN starfish0.020202
LOWER IN wild0.020202
LOWER IN coelomic fluid0.020202
LOWER IN patiria pectinifera0.020202
LOWER IN asterias amurensis0.020202
midgut0.020202
physopelta0.020202
air0.020202
LOWER IN eleventh decade human stage0.010101
LOWER IN centenarian human stage0.010101
25-44 year-old human stage0.010101
LOWER IN 80 year-old and over human stage0.010101
LOWER IN 25-44 year-old human stage0.010101
LOWER IN third trimester0.010101
LOWER IN pregnancy0.010101
LOWER IN non-pregnant0.010101
experimental cerebral malaria0.010101
LOWER IN experimental cerebral malaria0.010101
LOWER IN balb/c0.010101
Exp. ID User ID Description Date Region Flag Sequences
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
172amnondominant midgut, physopelta, japan2017-07-25v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
356amnonhigh freq. in deciduous broad leaved forest top soil in japan (dominant soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 3
172amnoncommon midgut, physopelta, japan2017-07-25v4No1 / 3
338amnon high in water pond water compared to skin in andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 3
287amnon high in depth 6-7m compared to depth 1-2m in snow field mountain japan 2018-01-29v4No1 / 4
923amnondominant japan, rat, sprague dawley, rattus norvegicus, oral cavity, research facility2022-07-27v3No1 / 4
550amnondominant city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 5
550amnon high in starfish wild coelomic fluid asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v4No1 / 5
550amnondominant city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v4No1 / 6
773amnon high in recurrent tonsillitis tonsillitis compared to iga glomerulonephritis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 6
550amnon high in asterias amurensis compared to patiria pectinifera in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 7
338amnon high in skin compared to water pond water in andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 7
807amnondominant tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 8
847amnon high in 25-44 year-old human stage compared to 80 year-old and over human stage ninth decade human stage in japan feces 2021-12-01v1No1 / 9
92amnoncommon air, japan2017-03-09v4No1 / 9
773amnonhigh in non iga bound bacteria compared to iga bound bacteria ( high in iga negative fraction compared to iga positive fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
773amnonhigh in iga bound bacteria compared to non iga bound bacteria ( high in iga positive fraction compared to iga negative fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in japan feces 2021-12-01v1No1 / 10
890amnoncommon pacific ocean, mikura-jima, japan, wild, feces, bottlenosed dolphin, tursiops truncatus2022-04-03v3No1 / 10
92amnondominant air, japan2017-03-09v4No1 / 10
847amnondominant 80 year-old and over human stage, ninth decade human stage, japan, feces2021-12-01v1No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
287amnon high in depth 1-2m compared to depth 6-7m in snow field mountain japan 2018-01-29v4No1 / 12
807amnondominant storm, typhoon, autumn, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 12
773amnon high in iga glomerulonephritis compared to recurrent tonsillitis tonsillitis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 12
847amnondominant centenarian human stage, eleventh decade human stage, japan, feces2021-12-01v1No1 / 13
890amnondominant mikura-jima, japan, wild, bottlenosed dolphin, pacific ocean, tursiops truncatus, feces2022-04-03v3No1 / 13
807amnondominant autumn, normal weather, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 14
807amnondominant normal weather, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 14
834amnondominant homo sapiens, feces, japan, adult2021-09-11v1No1 / 14
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
847amnondominant human early adulthood stage, japan, feces2021-12-01v1No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
550amnoncommon city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v4No1 / 15
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
807amnon high in normal weather compared to tropical storm in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 16
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
287amnondominant snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 17
807amnonlower during typhoon with red soil pollution compared to normal weather ( high in normal weather compared to storm typhoon in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
287amnondominant snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 18
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
550amnondominant sea water, hokkaido, city, japan2019-08-18v4No1 / 20
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
835amnondominant feces, homo sapiens, japan, adult2021-09-11v3No1 / 21
773amnondominant iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 21
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 22
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
773amnondominant recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 23
923amnoncommon oral cavity, japan, research facility, sprague dawley, rattus norvegicus, rat2022-07-27v3No1 / 24
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 51
847amnoncommon ninth decade human stage, 80 year-old and over human stage, japan, feces2021-12-01v1No1 / 52
847amnoncommon eleventh decade human stage, centenarian human stage, japan, feces2021-12-01v1No1 / 54
847amnoncommon human early adulthood stage, japan, feces2021-12-01v1No1 / 54
773amnoncommon iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 54
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
338amnon high in amphibian larval stage larval stage tadpole compared to adult in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 59
807amnon high in autumn compared to summer in normal weather okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 78
356amnonlower in non-snow covered period ( high in snow snow covered soil winter compared to non snow covered soil summer in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 78
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 93
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
807amnon high in summer compared to autumn in normal weather okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 109
356amnonhigher in non-snow covered period ( high in non snow covered soil summer compared to snow snow covered soil winter in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 113
807amnoncommon normal weather, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 142
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
807amnoncommon autumn, normal weather, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 240
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
550amnon high in patiria pectinifera compared to asterias amurensis in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 278
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 318
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
847amnon high in ninth decade human stage compared to eleventh decade human stage centenarian human stage in 80 year-old and over human stage japan feces 2021-12-01v1No1 / 341
847amnon high in centenarian human stage eleventh decade human stage compared to ninth decade human stage in 80 year-old and over human stage feces japan 2021-12-01v1No1 / 387
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
807amnoncommon storm, typhoon, autumn, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 447
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191

Problems / suggestions? Please email info AT dbbact DOT org