Summary for ontology term: jiangsu province

Number of annotations with term: 73

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCCTTGCAAGTTGGGTGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCGCCCAAAACTACGAGGCTTGAGTGCCGGAGAGGGTGGCGGAATTCCCGG0.237288
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGTCTGATGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATTGGAGACTGCACGGCTAGAGTGCGTCAGAGGGGGGTAGAATTCCACG0.234043
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.219780
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.217391
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.217391
d__Bacteria;p__Nitrospirae;c__"Nitrospira";o__"Nitrospirales";f__"Nitrospiraceae";g__NitrospiraTACGAAGGTGGCAAGCGTTGTTCGGATTTACTGGGCGTACAGGGAGCGTAGGCGGTTGGGTAAGCCCTCCGTGAAATCTCCAGGCTTAACCTGGAAAGTGCAGAGGGGACTGCTCAGCTAGAGGATGGGAGAGGAGCGCGGAATTCCCGG0.208333
d__BacteriaGACGTAGGGGGCGAGCGTTGCTCGGATTTACTGGGCGTAAAGAGCGCGTAGGCGGCCAGGGAAGTCCGGTGTGAAAGCCCTCGGCTCAACCGAGGACCCGCATTGGAAACTCCCTGGCTTGAGTCCAGGAGGGGAGGGTGGAATTCCCGG0.206897
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Gaiellales;f__Gaiellaceae;g__GaiellaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCCAGGTAGGTCGGCTGTGAAAACTCGAGGCTCAACCTCGAGATGTCGGCCGAAACCATCTGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCCGG0.204545
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCTTTAAGACTGCATCGCTAGAATCGTGGAGAGGTGAGTGGAATTCCGAG0.202020
d__BacteriaGACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGTCTGGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCCGGACTGGAGCCGTGCAGAGGGCGGTGGAATTGCCGG0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
jiangsu province0.611789
nanjing city prefecture0.329897
gleysol0.247423
sihong county0.247423
poplar0.247423
poplar plantation0.247423
chenwei forest0.247423
clay loam0.220183
yellow brown soil0.215054
solonchak0.179775
dafeng city0.179775
saline soil0.179775
fragaria x ananassa0.179775
strawberry0.179775
taihu national park0.175000
cultivated environment0.165138
qingpu district0.160920
pomacea canaliculata0.160920
golden apple snail0.160920
nanheng river0.160920
greenhouse soil0.152381
lake sediment0.148936
ryegrass0.141176
days 30-400.141176
ph 7.50.131868
10 cm depth0.131868
china0.120219
depth (water) 20-100cm0.108527
solanum lycopersicum0.104348
digesta0.104348
rhizosphere0.104009
sheep0.090226
pregnancy0.082759
ovis aries0.082759
ph 6-70.079734
female organism0.079470
biological fertilization0.075949
chicken manure0.075949
age 10 years0.075949
continuous cropping0.075949
intestine0.073801
chemical fertilization n,p,k0.073171
trichoderma guizhouense njau 47420.073171
restricted feed0.073171
soil0.070856
age 1 year0.070588
age 5 years0.070588
ph 7-80.064171
rumen0.062176
biochar0.061856
age >940.051948
tenth decade human stage0.051948
age 13-140.051948
age 8-120.051948
age 3-60.051948
depth 30-4cm0.051948
depth 40-50cm0.051948
sediment surface0.051948
procambarus clarkii0.051948
red swamp crayfish0.051948
buccal mass0.051948
ninth decade human stage0.050633
65-79 year-old human stage0.050633
14-year-old human stage0.050633
depth 10-20cm0.050633
rice field0.050633
rex rabbit0.050633
fifth decade human stage0.049383
13-year-old human stage0.049383
depth (soil) 20-30cm0.049383
stomach0.048387
6-12 year-old child stage0.048193
ph 7.60.047059
fourth decade human stage0.045977
oryctolagus cuniculus0.044944
farm0.044321
2-5 year-old child stage0.042105
depth (soil) 0-10cm0.040404
fish0.038835
child0.036866
caecum0.027586
spring0.027027
LOWER IN spring0.027027
LOWER IN biological fertilization0.026667
LOWER IN chicken manure0.026667
LOWER IN age 10 years0.026667
LOWER IN continuous cropping0.026667
LOWER IN sediment surface0.026667
LOWER IN buccal mass0.026667
female0.026608
LOWER IN trichoderma guizhouense njau 47420.026316
LOWER IN chemical fertilization n,p,k0.026316
LOWER IN depth 20-40cm0.026316
depth 20-40cm0.026316
LOWER IN without biochar0.026316
without biochar0.026316
paddy field soil0.026316
LOWER IN restricted feed0.026316
LOWER IN age 5 years0.025974
LOWER IN age 1 year0.025974
Fraction of dbbact annotations with this term covered by the query
TermScore
spring1.000000
LOWER IN spring1.000000
taihu national park1.000000
nanjing city prefecture0.666667
jiangsu province0.636364
age >940.500000
tenth decade human stage0.500000
age 13-140.500000
age 8-120.500000
age 3-60.500000
solonchak0.500000
dafeng city0.500000
saline soil0.500000
LOWER IN biological fertilization0.500000
LOWER IN chicken manure0.500000
biological fertilization0.500000
chicken manure0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
age 10 years0.500000
continuous cropping0.500000
gleysol0.500000
sihong county0.500000
poplar0.500000
poplar plantation0.500000
chenwei forest0.500000
depth 30-4cm0.500000
depth 40-50cm0.500000
ryegrass0.500000
days 30-400.500000
sediment surface0.500000
LOWER IN sediment surface0.500000
procambarus clarkii0.500000
red swamp crayfish0.500000
qingpu district0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
buccal mass0.500000
LOWER IN buccal mass0.500000
ninth decade human stage0.333333
65-79 year-old human stage0.333333
14-year-old human stage0.333333
chemical fertilization n,p,k0.333333
ph 7.50.333333
LOWER IN trichoderma guizhouense njau 47420.333333
trichoderma guizhouense njau 47420.333333
LOWER IN chemical fertilization n,p,k0.333333
clay loam0.333333
depth 10-20cm0.333333
LOWER IN depth 20-40cm0.333333
depth 20-40cm0.333333
10 cm depth0.333333
LOWER IN without biochar0.333333
without biochar0.333333
paddy field soil0.333333
lake sediment0.333333
rice field0.333333
rex rabbit0.333333
restricted feed0.333333
LOWER IN restricted feed0.333333
fifth decade human stage0.250000
13-year-old human stage0.250000
greenhouse soil0.250000
cultivated environment0.250000
age 1 year0.250000
LOWER IN age 5 years0.250000
age 5 years0.250000
LOWER IN age 1 year0.250000
depth (soil) 20-30cm0.250000
6-12 year-old child stage0.200000
ph 7.60.166667
fourth decade human stage0.142857
solanum lycopersicum0.142857
oryza sativa0.142857
digesta0.142857
biochar0.125000
LOWER IN biochar0.125000
depth (water) 20-100cm0.125000
oryctolagus cuniculus0.125000
sheep0.100000
2-5 year-old child stage0.090909
pregnancy0.083333
ovis aries0.083333
intestine0.080000
depth (soil) 0-10cm0.076923
LOWER IN depth (soil) 0-10cm0.076923
female organism0.076923
rhizosphere0.068182
fish0.066667
china0.063953
LOWER IN winter0.058824
winter0.058824
stomach0.058824
LOWER IN stomach0.058824
ph 6-70.052632
ph 7-80.052632
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
jiangsu province0.589041
soil0.287671
rhizosphere0.219178
nanjing city prefecture0.219178
feces0.164384
homo sapiens0.164384
clay loam0.164384
ph 6-70.164384
gleysol0.164384
sihong county0.164384
poplar0.164384
poplar plantation0.164384
chenwei forest0.164384
yellow brown soil0.136986
cultivated environment0.123288
adult0.109589
solonchak0.109589
dafeng city0.109589
saline soil0.109589
farm0.109589
greenhouse soil0.109589
fragaria x ananassa0.109589
strawberry0.109589
research facility0.109589
lake sediment0.095890
taihu national park0.095890
depth (water) 20-100cm0.095890
taihu lake0.095890
qingpu district0.095890
pomacea canaliculata0.095890
golden apple snail0.095890
nanheng river0.095890
solanum lycopersicum0.082192
ph 7.50.082192
10 cm depth0.082192
ph 7-80.082192
ryegrass0.082192
days 30-400.082192
female0.082192
pregnancy0.082192
rumen0.082192
ovis aries0.082192
digesta0.082192
sheep0.082192
female organism0.082192
depth (sediment) 0-20cm0.068493
intestine0.068493
child0.054795
chemical fertilization n,p,k0.041096
trichoderma guizhouense njau 47420.041096
biological fertilization0.041096
chicken manure0.041096
age 1 year0.041096
age 5 years0.041096
age 10 years0.041096
continuous cropping0.041096
biochar0.041096
restricted feed0.041096
control0.041096
stomach0.041096
age >940.027397
ninth decade human stage0.027397
tenth decade human stage0.027397
65-79 year-old human stage0.027397
fourth decade human stage0.027397
fifth decade human stage0.027397
age 13-140.027397
13-year-old human stage0.027397
14-year-old human stage0.027397
age 8-120.027397
6-12 year-old child stage0.027397
age 3-60.027397
2-5 year-old child stage0.027397
ph 7.60.027397
depth (soil) 0-10cm0.027397
depth 10-20cm0.027397
depth (soil) 20-30cm0.027397
depth 30-4cm0.027397
depth 40-50cm0.027397
sediment surface0.027397
depth (sediment) 0cm0.027397
rice field0.027397
fish0.027397
procambarus clarkii0.027397
red swamp crayfish0.027397
caecum0.027397
oryctolagus cuniculus0.027397
rex rabbit0.027397
buccal mass0.027397
LOWER IN trichoderma guizhouense njau 47420.013699
LOWER IN biological fertilization0.013699
LOWER IN chicken manure0.013699
LOWER IN chemical fertilization n,p,k0.013699
spring0.013699
LOWER IN winter0.013699
winter0.013699
LOWER IN spring0.013699
LOWER IN age 5 years0.013699
LOWER IN age 10 years0.013699
Exp. ID User ID Description Date Region Flag Sequences
444amnonhigh freq. in uncultivated soil plot (dominant soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 1
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 5
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 6
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 8
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 9
746sheryoDominant in saline soil in dafeng, china (dominant jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 10
735amnondominant female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 10
444amnon high in spring compared to winter in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
264amnondominant research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 11
585amnon high in intestine stomach compared to buccal mass in china qingpu district pomacea canaliculata golden apple snail nanheng river 2020-02-02v3No1 / 11
585amnon high in buccal mass compared to intestine stomach in china qingpu district pomacea canaliculata golden apple snail nanheng river 2020-02-02v3No1 / 13
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 14
585amnondominant intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 14
585amnondominant stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 14
585amnondominant china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river, buccal mass2020-02-02v3No1 / 16
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 18
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
581amnondominant in red swamp crayfish grown in flooded rice field (dominant rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 21
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in soil rhizosphere 10 cm depth jiangsu province ph 7-8 china ryegrass days 30-40 )2020-05-11v4No1 / 30
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in soil rhizosphere 10 cm depth jiangsu province ph 7-8 china ryegrass days 30-40 )2020-05-11v4No1 / 59
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 65
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 122
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
585amnoncommon stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 194
585amnoncommon intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 240
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 biological fertilization chicken manure in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 269
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 321
444amnonhigher in continuously cropped strawberry soil ( high in age 5 years age 10 years continuous cropping compared to age 1 year in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 602
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 biological fertilization chicken manure compared to chemical fertilization n,p,k in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 703
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 811
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
901amnon high in depth (sediment) 0-20cm compared to sediment surface depth (sediment) 0cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 939
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 993
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
901amnon high in bulk sediment compared to rhizosphere in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1228
901amnoncommon lake sediment, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake2022-04-25v4No1 / 1246
901amnoncommon in macrophyte plant rhizosphere (common lake sediment, rhizosphere, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake)2022-04-25v4No1 / 1378
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
901amnoncommon lake sediment, sediment surface, china, taihu national park, depth (water) 20-100cm, taihu lake, depth (sediment) 0cm2022-04-25v4No1 / 1550
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 1819
901amnon high in rhizosphere compared to bulk sediment in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1892

Problems / suggestions? Please email info AT dbbact DOT org