Summary for ontology term: jiangsu province

Number of annotations with term: 79

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCCTTGCAAGTTGGGTGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCGCCCAAAACTACGAGGCTTGAGTGCCGGAGAGGGTGGCGGAATTCCCGG0.225806
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGTCTGATGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATTGGAGACTGCACGGCTAGAGTGCGTCAGAGGGGGGTAGAATTCCACG0.220000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.206186
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.204082
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.204082
d__Bacteria;p__Nitrospirae;c__"Nitrospira";o__"Nitrospirales";f__"Nitrospiraceae";g__NitrospiraTACGAAGGTGGCAAGCGTTGTTCGGATTTACTGGGCGTACAGGGAGCGTAGGCGGTTGGGTAAGCCCTCCGTGAAATCTCCAGGCTTAACCTGGAAAGTGCAGAGGGGACTGCTCAGCTAGAGGATGGGAGAGGAGCGCGGAATTCCCGG0.200000
d__BacteriaGACGTAGGGGGCGAGCGTTGCTCGGATTTACTGGGCGTAAAGAGCGCGTAGGCGGCCAGGGAAGTCCGGTGTGAAAGCCCTCGGCTCAACCGAGGACCCGCATTGGAAACTCCCTGGCTTGAGTCCAGGAGGGGAGGGTGGAATTCCCGG0.193548
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Gaiellales;f__Gaiellaceae;g__GaiellaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCCAGGTAGGTCGGCTGTGAAAACTCGAGGCTCAACCTCGAGATGTCGGCCGAAACCATCTGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCCGG0.191489
d__BacteriaGACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGTCTGGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCCGGACTGGAGCCGTGCAGAGGGCGGTGGAATTGCCGG0.190476
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCTTTAAGACTGCATCGCTAGAATCGTGGAGAGGTGAGTGGAATTCCGAG0.190476

Annotations:

common ontology terms
term enrichment score
TermScore
jiangsu province0.541367
nanjing city prefecture0.406154
gleysol0.233010
sihong county0.233010
chenwei forest0.233010
poplar plantation0.233010
poplar0.233010
clay loam0.208696
yellow brown soil0.202020
dafeng city0.168421
solonchak0.168421
saline soil0.168421
fragaria x ananassa0.168421
strawberry0.168421
cultivated environment0.156522
taihu lake0.150538
taihu national park0.150538
pomacea canaliculata0.150538
golden apple snail0.150538
nanheng river0.150538
greenhouse soil0.144144
qingpu district0.140000
days 30-400.131868
ryegrass0.131868
ph 7.50.123711
10 cm depth0.123711
lake sediment0.122807
china0.121827
depth (sediment) 0-20cm0.106383
solanum lycopersicum0.099174
digesta0.099174
rhizosphere0.097068
depth (water) 20-100cm0.093960
sheep0.082759
ph 6-70.078176
pregnancy0.076433
ovis aries0.076433
female organism0.073620
spinal cord injury0.070588
biological fertilization0.070588
chicken manure0.070588
continuous cropping0.070588
age 10 years0.070588
intestine0.069444
soil0.068937
chemical fertilization n,p,k0.068182
trichoderma guizhouense njau 47420.068182
restricted feed0.068182
age 5 years0.065934
age 1 year0.063830
ph 7-80.062176
biochar0.058252
rumen0.055300
tenth decade human stage0.048193
age >940.048193
age 13-140.048193
age 8-120.048193
age 3-60.048193
depth 30-4cm0.048193
depth 40-50cm0.048193
depth (sediment) 0cm0.048193
procambarus clarkii0.048193
red swamp crayfish0.048193
buccal mass0.048193
ninth decade human stage0.047059
65-79 year-old human stage0.047059
14-year-old human stage0.047059
depth 10-20cm0.047059
sediment surface0.047059
rice field0.047059
rex rabbit0.047059
stomach0.046154
fifth decade human stage0.045977
13-year-old human stage0.045977
depth (soil) 20-30cm0.045977
6-12 year-old child stage0.043956
ph 7.60.043956
farm0.042667
fourth decade human stage0.042105
oryctolagus cuniculus0.042105
human adult stage0.039867
2-5 year-old child stage0.038095
depth (soil) 0-10cm0.038095
fish0.036697
child0.034043
female0.025263
LOWER IN spinal cord injury0.024691
LOWER IN chicken manure0.024691
LOWER IN biological fertilization0.024691
LOWER IN age 10 years0.024691
LOWER IN continuous cropping0.024691
LOWER IN bulk sediment0.024691
bulk sediment0.024691
LOWER IN depth (sediment) 0cm0.024691
LOWER IN buccal mass0.024691
caecum0.024540
LOWER IN trichoderma guizhouense njau 47420.024390
LOWER IN chemical fertilization n,p,k0.024390
LOWER IN depth 20-40cm0.024390
depth 20-40cm0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
nanjing city prefecture0.750000
jiangsu province0.538462
LOWER IN spinal cord injury0.500000
spinal cord injury0.500000
tenth decade human stage0.500000
age >940.500000
age 13-140.500000
age 8-120.500000
age 3-60.500000
dafeng city0.500000
solonchak0.500000
saline soil0.500000
LOWER IN chicken manure0.500000
LOWER IN biological fertilization0.500000
biological fertilization0.500000
chicken manure0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
continuous cropping0.500000
age 10 years0.500000
gleysol0.500000
sihong county0.500000
chenwei forest0.500000
poplar plantation0.500000
poplar0.500000
depth 30-4cm0.500000
depth 40-50cm0.500000
days 30-400.500000
ryegrass0.500000
taihu lake0.500000
taihu national park0.500000
depth (sediment) 0cm0.500000
LOWER IN bulk sediment0.500000
bulk sediment0.500000
LOWER IN depth (sediment) 0cm0.500000
procambarus clarkii0.500000
red swamp crayfish0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
buccal mass0.500000
LOWER IN buccal mass0.500000
ninth decade human stage0.333333
65-79 year-old human stage0.333333
14-year-old human stage0.333333
chemical fertilization n,p,k0.333333
ph 7.50.333333
LOWER IN trichoderma guizhouense njau 47420.333333
trichoderma guizhouense njau 47420.333333
LOWER IN chemical fertilization n,p,k0.333333
clay loam0.333333
depth 10-20cm0.333333
LOWER IN depth 20-40cm0.333333
depth 20-40cm0.333333
10 cm depth0.333333
LOWER IN without biochar0.333333
without biochar0.333333
paddy field soil0.333333
depth (sediment) 0-20cm0.333333
sediment surface0.333333
LOWER IN depth (sediment) 0-20cm0.333333
LOWER IN sediment surface0.333333
rice field0.333333
rex rabbit0.333333
restricted feed0.333333
LOWER IN restricted feed0.333333
qingpu district0.333333
fifth decade human stage0.250000
13-year-old human stage0.250000
greenhouse soil0.250000
cultivated environment0.250000
LOWER IN age 5 years0.250000
age 5 years0.250000
depth (soil) 20-30cm0.250000
age 1 year0.200000
LOWER IN age 1 year0.200000
lake sediment0.200000
6-12 year-old child stage0.166667
ph 7.60.166667
solanum lycopersicum0.142857
oryza sativa0.142857
digesta0.142857
fourth decade human stage0.125000
biochar0.125000
LOWER IN biochar0.125000
oryctolagus cuniculus0.125000
depth (water) 20-100cm0.100000
sheep0.090909
2-5 year-old child stage0.076923
depth (soil) 0-10cm0.076923
LOWER IN depth (soil) 0-10cm0.076923
intestine0.076923
pregnancy0.076923
ovis aries0.076923
female organism0.071429
fish0.066667
china0.064865
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
jiangsu province0.544304
nanjing city prefecture0.278481
soil0.265823
homo sapiens0.227848
feces0.227848
rhizosphere0.202532
ph 6-70.151899
clay loam0.151899
gleysol0.151899
sihong county0.151899
chenwei forest0.151899
poplar plantation0.151899
poplar0.151899
yellow brown soil0.126582
cultivated environment0.113924
adult0.101266
dafeng city0.101266
solonchak0.101266
saline soil0.101266
fragaria x ananassa0.101266
strawberry0.101266
greenhouse soil0.101266
farm0.101266
research facility0.101266
taihu lake0.088608
taihu national park0.088608
depth (water) 20-100cm0.088608
lake sediment0.088608
pomacea canaliculata0.088608
golden apple snail0.088608
nanheng river0.088608
qingpu district0.088608
control0.075949
human adult stage0.075949
solanum lycopersicum0.075949
ph 7.50.075949
days 30-400.075949
ryegrass0.075949
ph 7-80.075949
10 cm depth0.075949
pregnancy0.075949
digesta0.075949
rumen0.075949
female organism0.075949
female0.075949
sheep0.075949
ovis aries0.075949
depth (sediment) 0-20cm0.063291
intestine0.063291
child0.050633
spinal cord injury0.037975
chemical fertilization n,p,k0.037975
biological fertilization0.037975
chicken manure0.037975
trichoderma guizhouense njau 47420.037975
age 1 year0.037975
continuous cropping0.037975
age 5 years0.037975
age 10 years0.037975
biochar0.037975
restricted feed0.037975
stomach0.037975
LOWER IN control0.025316
tenth decade human stage0.025316
ninth decade human stage0.025316
age >940.025316
65-79 year-old human stage0.025316
fifth decade human stage0.025316
fourth decade human stage0.025316
14-year-old human stage0.025316
13-year-old human stage0.025316
age 13-140.025316
6-12 year-old child stage0.025316
age 8-120.025316
2-5 year-old child stage0.025316
age 3-60.025316
ph 7.60.025316
depth (soil) 0-10cm0.025316
depth 10-20cm0.025316
depth (soil) 20-30cm0.025316
depth 30-4cm0.025316
depth 40-50cm0.025316
sediment surface0.025316
depth (sediment) 0cm0.025316
procambarus clarkii0.025316
red swamp crayfish0.025316
fish0.025316
rice field0.025316
oryctolagus cuniculus0.025316
rex rabbit0.025316
caecum0.025316
buccal mass0.025316
LOWER IN spinal cord injury0.012658
LOWER IN trichoderma guizhouense njau 47420.012658
LOWER IN chicken manure0.012658
LOWER IN biological fertilization0.012658
LOWER IN chemical fertilization n,p,k0.012658
spring0.012658
LOWER IN winter0.012658
Number of experiments associating the term to the sequence
TermScore
china12.000000
jiangsu province7.000000
soil4.000000
nanjing city prefecture3.000000
rhizosphere3.000000
control2.000000
homo sapiens2.000000
feces2.000000
LOWER IN control2.000000
adult2.000000
cultivated environment2.000000
intestine2.000000
research facility2.000000
LOWER IN spinal cord injury1.000000
human adult stage1.000000
spinal cord injury1.000000
tenth decade human stage1.000000
ninth decade human stage1.000000
age >941.000000
65-79 year-old human stage1.000000
fifth decade human stage1.000000
fourth decade human stage1.000000
14-year-old human stage1.000000
13-year-old human stage1.000000
age 13-141.000000
6-12 year-old child stage1.000000
child1.000000
age 8-121.000000
2-5 year-old child stage1.000000
age 3-61.000000
ph 7.61.000000
dafeng city1.000000
solonchak1.000000
saline soil1.000000
chemical fertilization n,p,k1.000000
solanum lycopersicum1.000000
ph 7.51.000000
LOWER IN trichoderma guizhouense njau 47421.000000
LOWER IN chicken manure1.000000
LOWER IN biological fertilization1.000000
biological fertilization1.000000
chicken manure1.000000
trichoderma guizhouense njau 47421.000000
LOWER IN chemical fertilization n,p,k1.000000
spring1.000000
fragaria x ananassa1.000000
strawberry1.000000
greenhouse soil1.000000
farm1.000000
yellow brown soil1.000000
LOWER IN winter1.000000
age 1 year1.000000
LOWER IN age 5 years1.000000
LOWER IN age 10 years1.000000
LOWER IN continuous cropping1.000000
continuous cropping1.000000
age 5 years1.000000
age 10 years1.000000
LOWER IN age 1 year1.000000
depth (soil) 0-10cm1.000000
ph 6-71.000000
clay loam1.000000
gleysol1.000000
sihong county1.000000
chenwei forest1.000000
poplar plantation1.000000
poplar1.000000
depth 10-20cm1.000000
depth (soil) 20-30cm1.000000
depth 30-4cm1.000000
depth 40-50cm1.000000
LOWER IN depth 20-40cm1.000000
LOWER IN depth (soil) 0-10cm1.000000
depth 20-40cm1.000000
days 30-401.000000
ryegrass1.000000
ph 7-81.000000
10 cm depth1.000000
biochar1.000000
LOWER IN without biochar1.000000
LOWER IN biochar1.000000
without biochar1.000000
paddy field soil1.000000
oryza sativa1.000000
depth (sediment) 0-20cm1.000000
taihu lake1.000000
taihu national park1.000000
depth (water) 20-100cm1.000000
lake sediment1.000000
sediment surface1.000000
depth (sediment) 0cm1.000000
LOWER IN bulk sediment1.000000
bulk sediment1.000000
LOWER IN depth (sediment) 0-20cm1.000000
LOWER IN sediment surface1.000000
LOWER IN depth (sediment) 0cm1.000000
procambarus clarkii1.000000
red swamp crayfish1.000000
fish1.000000
rice field1.000000
oryctolagus cuniculus1.000000
rex rabbit1.000000
caecum1.000000
restricted feed1.000000
pregnancy1.000000
digesta1.000000
rumen1.000000
female organism1.000000
female1.000000
sheep1.000000
ovis aries1.000000
LOWER IN restricted feed1.000000
pomacea canaliculata1.000000
golden apple snail1.000000
nanheng river1.000000
qingpu district1.000000
buccal mass1.000000
stomach1.000000
LOWER IN buccal mass1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
444amnonhigh freq. in uncultivated soil plot (dominant yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v41 / 1approvedNo
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v41 / 3approvedNo
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 3approvedNo
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 5approvedNo
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v41 / 5approvedNo
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v41 / 6approvedNo
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v31 / 8approvedNo
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 9approvedNo
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v41 / 9approvedNo
746sheryoDominant in saline soil in dafeng, china (dominant ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v41 / 10approvedNo
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 10approvedNo
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 10approvedNo
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v31 / 10approvedNo
444amnon high in spring compared to winter in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v41 / 11approvedNo
444amnon high in winter compared to spring in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v41 / 11approvedNo
264amnondominant oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v41 / 11approvedNo
585amnon high in stomach intestine compared to buccal mass in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v31 / 11approvedNo
585amnon high in buccal mass compared to stomach intestine in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v31 / 13approvedNo
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v41 / 14approvedNo
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v41 / 14approvedNo
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v31 / 14approvedNo
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v31 / 14approvedNo
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v31 / 16approvedNo
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v41 / 18approvedNo
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 19approvedNo
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v41 / 21approvedNo
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v41 / 21approvedNo
581amnondominant in red swamp crayfish grown in flooded rice field (dominant procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v31 / 21approvedNo
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 25approvedNo
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 26approvedNo
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 27approvedNo
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v41 / 29approvedNo
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 30approvedNo
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v41 / 30approvedNo
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 51approvedNo
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v41 / 56approvedNo
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v41 / 59approvedNo
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v31 / 65approvedNo
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 81approvedNo
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 106approvedNo
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 109approvedNo
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 111approvedNo
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v31 / 112approvedNo
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 115approvedNo
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v41 / 121approvedNo
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v31 / 122approvedNo
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v41 / 134approvedNo
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v31 / 194approvedNo
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v31 / 240approvedNo
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 chicken manure biological fertilization in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v41 / 269approvedNo
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v41 / 312approvedNo
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v41 / 321approvedNo
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v41 / 602approvedNo
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v41 / 622approvedNo
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 chicken manure biological fertilization compared to chemical fertilization n,p,k in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v41 / 703approvedNo
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v31 / 744approvedNo
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v31 / 761approvedNo
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 790approvedNo
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v41 / 811approvedNo
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v41 / 833approvedNo
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 844approvedNo
901amnon high in depth (sediment) 0-20cm compared to sediment surface depth (sediment) 0cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v41 / 939approvedNo
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v41 / 946approvedNo
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v41 / 957approvedNo
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v41 / 966approvedNo
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 989approvedNo
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v41 / 993approvedNo
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v41 / 1017approvedNo
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 1069approvedNo
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v41 / 1123approvedNo
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v41 / 1170approvedNo
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v41 / 1221approvedNo
901amnon high in bulk sediment compared to rhizosphere in taihu lake depth (sediment) 0-20cm depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v41 / 1228approvedNo
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v41 / 1246approvedNo
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v41 / 1378approvedNo
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v41 / 1439approvedNo
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v41 / 1550approvedNo
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v41 / 1819approvedNo
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v41 / 1892approvedNo

Problems / suggestions? Please email info AT dbbact DOT org