Summary for ontology term: juvenile organism

Number of annotations with term: 26

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGTGCAAGCGTTAATCGGAATCATTGGGCGTAAAGGGTGCGTAGGCGGATACATAAGCTTGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATTAAGGACGATGTATCTAGAGTTCGGTAGAGGGGGGTAGAATTCCATG0.130435
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTATTAAGCCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGGAACTGATTCGCTAGAGTACAGTAGAGGGTGGTGGAATTTCCAG0.130435
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACCGCATTTGAAACTGGCAGGCTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG0.130435
d__Bacteria;p__"Proteobacteria"TACGAAGGGTGCTAGCGTTGTTCGGAATTATTGGGCGTAAAGCGTATGTAGGCGGCTTGGTAAGTCAATTGTGAAATCCCTAGGCTCAACCTAGGAACTGCAATCGAAACTGCCTTGCTTGAGTTCGGTAGGGGATAGTGGAACTCCTAG0.130435
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGATTGTTAAGTCAGATGTGAAATACCCGGGCTCAACCTGGGAATTGCGTTTGATACTGGCAATCTAGAGTATGGTAGAGGGTAGTGGAATTCCTGG0.130435
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.086957
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Oceanospirillales;f__Oceanospirillaceae;g__MarinobacteriumTACGGAGGGTCCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTTGTCAGTCAGATGTGAAAGCCCAGGGCTCAACCTTGGAATTGCACCTGATACTGCAAGACTAGAGTACGATAGAGGGGAGTGGAATTTCCGG0.086957
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTGTTCAAGCCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGGAACTGGGCAGCTAGAGTACAGCAGAGGAGTGTGGAATTTCAGG0.086957
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGATAATTAAGTCAGAGGTGAAATCTTGCCGCTCAACGGTAAAATTGCCTTTGATACTGGTTATCTTGAATTATTATGAAGTGGTTAGAATATGTAG0.086957
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__CryomorphaceaeTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTATTATAAGTCAGTGGTGAAAGCCTACAGCTTAACTGTAGAACTGCCATTGATACTGTAGTACTTGAGTTCGGTCGAAGTTGGCGGAATATGTAG0.086957

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Verrucomicrobia"TACGAAGGTCCCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGCGTGGAAAGTCAGGTGTGAAAGCCCGGGGCTCAACCCCGGAATTGCACCCGATACTCCCACGCTAGAGTAATGGAGGGGAGTCTGGAATTTACGG0.800000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTAGTTAAGTCGGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTCGATACTGGCCAACTAGAGTACGAGAGAGGGAGGTAGAATTCCACG0.800000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCATTTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTATTTGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.800000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGGTCAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGATACTGCTAAGCTAGAGTATGGTAGAGGCAAGTGGAATTCCAGG0.800000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTGTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTACTAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.800000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTTGGATGTGAAAGCCTATGGCTCAACCATAGAACTGCATCCAAAACTATCAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.800000
d__BacteriaTACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGAGTACGTAGGCGGTTTGGTAAGTCAGGTGTGAAATCCCGGAGCTCAACTTCGGAACTGCACCCGATACTGCTAGACTGGAGTAATGGAGAGGCAGGTGGAATTCTCGG0.800000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGGTAGAGGGGGGTAGAATTCATAG0.800000
d__BacteriaTACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGAGTACGTAGGCGGTTTGGTAAGTCAGGTGTGAAATCCCGGAGCTCAACTTCGGAACTGCACCCGATACTGCCAGACTGGAGTAATGGAGAGGCAGGTGGAATTCTCGG0.600000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales"TACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGACTTTCAAGTCAGTGGTGAAATCTCACAGCTTAACTGTGAAACTGCCATTGAAACTGTTAGTCTTGAATTCGGTCGAAGTGGGCGGAATATGTCA0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGCAGGCCGCCTATTAAGCGTGCCGTGAAATGCCGCGGCTCAACCGTGGCACTGCGGCGCGAACTGGTGGGCTTGGGTGCGCGGAAGGCAGGCGGAATTCGTGG0.193548
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGATTGTTAAGTCAGATGTGAAATACCCGGGCTCAACCTGGGAATTGCGTTTGATACTGGCAATCTAGAGTATGGTAGAGGGTAGTGGAATTCCTGG0.193548
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTATTAAGCCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGGAACTGATTCGCTAGAGTACAGTAGAGGGTGGTGGAATTTCCAG0.187500
d__Bacteria;p__"Proteobacteria"TACGAAGGGTGCTAGCGTTGTTCGGAATTATTGGGCGTAAAGCGTATGTAGGCGGCTTGGTAAGTCAATTGTGAAATCCCTAGGCTCAACCTAGGAACTGCAATCGAAACTGCCTTGCTTGAGTTCGGTAGGGGATAGTGGAACTCCTAG0.181818
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGCCGTTTAAGTCAGCTGTGAAATGGTGCGGCTCAACCGTAGCACTGCAGTTGAAACTGGACGGCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.176471
d__BacteriaTACGTAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTCGTTAAGTCTGCTGTCAAAGGCTGAGGCTCAACCTCAGTTCTACAACAGATACTGGCGGACTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.171429
d__BacteriaTACGTAGGGTGCAAGCGTTAATCGGAATCATTGGGCGTAAAGGGTGCGTAGGCGGATACATAAGCTTGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATTAAGGACGATGTATCTAGAGTTCGGTAGAGGGGGGTAGAATTCCATG0.166667
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCCCCGTCAGTCAGTGGTGAAAGTCCGTGGCTCAACCATGGAATCGCCATTGAAACCACGGGGCTTGAGTATGATTGAGGTAGGCGGAACGCGTGG0.157895
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTGATCAAGTCAGCGGTGAAATCCTCGGGCTTAACCCGAGGCATGCCGATGAAACTGATAGACTAGCGTATGGTAGAGGTATGCGGAATGCGTGG0.153846
d__Bacteria;p__FirmicutesTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGACATTAAGTTAGTTGTGAAAGCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTGATATTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.153846

Annotations:

common ontology terms
term enrichment score
TermScore
juvenile organism0.893617
ria formosa0.380952
open water pond0.380952
portuguese republic0.320000
LOWER IN juvenile organism0.243902
fish farm0.242424
13-year-old human stage0.240000
sparus aurata0.235294
seabream0.235294
dicentrarchus labrax0.235294
seabass0.235294
calve0.235294
age 3 years0.210526
LOWER IN age 3 years0.210526
state of washington0.190476
gill0.173913
macaca mulatta0.160000
obsolete_juvenile stage0.139535
adult organism0.137931
LOWER IN adult organism0.137931
LOWER IN age 1-2 years0.133333
age 1-2 years0.133333
finland0.127660
india0.127660
green turtle0.125000
chelonia mydas0.125000
juvenile0.125000
age 21 days0.125000
age 1 year0.117647
LOWER IN age 1 year0.117647
nasal cavity0.114286
zebra fish0.111111
danio rerio0.105263
state of oregon0.105263
monkey0.097561
pair of nares0.097561
state of georgia0.095238
bos taurus0.085106
LOWER IN neonate0.074074
neonate0.074074
fish0.071429
low selenium0.071429
LOWER IN low selenium0.071429
LOWER IN selenium0.068966
selenium0.068966
LOWER IN age 1 week0.066667
age 1 week0.066667
LOWER IN india0.060606
LOWER IN finland0.060606
intestine0.052632
skin0.050633
research facility0.038278
united states of america0.031291
feces0.018721
control0.009479
LOWER IN control0.009479
homo sapiens0.007264
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
juvenile organism1.000000
LOWER IN neonate1.000000
neonate1.000000
LOWER IN age 1-2 years0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
age 1-2 years0.500000
dicentrarchus labrax0.500000
seabass0.500000
low selenium0.500000
calve0.500000
LOWER IN low selenium0.500000
green turtle0.333333
chelonia mydas0.333333
juvenile0.333333
age 3 years0.333333
LOWER IN juvenile organism0.333333
portuguese republic0.333333
LOWER IN age 3 years0.333333
age 21 days0.333333
LOWER IN selenium0.333333
selenium0.333333
age 1 year0.250000
13-year-old human stage0.250000
LOWER IN age 1 year0.250000
state of washington0.250000
LOWER IN age 1 week0.250000
age 1 week0.250000
fish farm0.200000
gill0.200000
zebra fish0.200000
danio rerio0.166667
state of oregon0.166667
macaca mulatta0.166667
finland0.142857
LOWER IN india0.142857
india0.142857
LOWER IN finland0.142857
state of georgia0.125000
adult organism0.125000
LOWER IN adult organism0.125000
obsolete_juvenile stage0.100000
nasal cavity0.090909
monkey0.071429
pair of nares0.071429
fish0.066667
bos taurus0.058824
intestine0.040000
skin0.030303
research facility0.020408
united states of america0.016194
feces0.009554
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of annotations for the query sequences containing the term
TermScore
juvenile organism0.807692
feces0.461538
united states of america0.461538
research facility0.307692
fish farm0.307692
portuguese republic0.307692
ria formosa0.307692
open water pond0.307692
homo sapiens0.230769
obsolete_juvenile stage0.230769
13-year-old human stage0.230769
LOWER IN juvenile organism0.192308
adult organism0.153846
age 3 years0.153846
gill0.153846
sparus aurata0.153846
seabream0.153846
LOWER IN adult organism0.153846
LOWER IN age 3 years0.153846
skin0.153846
dicentrarchus labrax0.153846
seabass0.153846
macaca mulatta0.153846
state of washington0.153846
monkey0.153846
nasal cavity0.153846
pair of nares0.153846
bos taurus0.153846
calve0.153846
finland0.115385
india0.115385
age 20 months0.115385
state of georgia0.076923
green turtle0.076923
chelonia mydas0.076923
juvenile0.076923
LOWER IN age 1-2 years0.076923
age 1-2 years0.076923
age 1 year0.076923
LOWER IN age 1 year0.076923
intestine0.076923
danio rerio0.076923
state of oregon0.076923
zebra fish0.076923
fish0.076923
age 21 days0.076923
LOWER IN india0.038462
LOWER IN finland0.038462
LOWER IN age 1 week0.038462
LOWER IN neonate0.038462
age 1 week0.038462
neonate0.038462
LOWER IN age 20 months0.038462
control0.038462
low selenium0.038462
LOWER IN selenium0.038462
selenium0.038462
LOWER IN control0.038462
LOWER IN low selenium0.038462
Exp. ID User ID Description Date Region Flag Sequences
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 1
157amnonhigh freq. in naers of weened calves (dominant united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 13
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
437amnondominant united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 26
782amnon high in adult organism age 3 years compared to juvenile organism age 1-2 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 27
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 41
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 43
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
782amnon high in adult organism age 3 years compared to juvenile organism age 1-2 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 66
782amnon high in juvenile organism age 1 year compared to adult organism age 3 years in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 67
782amnon high in juvenile organism age 1 year compared to adult organism age 3 years in fish farm gill portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 87
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm gill portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 147
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065

Problems / suggestions? Please email info AT dbbact DOT org