Summary for ontology term: karen

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGGTGGAGAGGCAAATGGAATTCCTAG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAACTGCAAGTCAGATGTGAAATCCTGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGTCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.250000
d__BacteriaTACGTAGGATGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGCGGTAAATCAAGTTGGCAGCGTAATTCCGGGGCTTAACCGCGGAACTACTGCCAAAACTGGTGAACTAGAGTGTGTCAGGGGTAAGTGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTACGTAGGTGGCTATTCAAGTTAGTTGTGAAATCCCGGGGCTTAACTCCGGTGCTACAATTAAGACTGTTTAGCTTGAGTGCAGGAGGGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGAAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGGTGTGAAAACCAGGGGCTCAACCTCTGGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCGGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTACGTCAGAGGGGGGTGGAATTCCGCG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATTGCAAGTCAGATGTGAAATGTATGGGCTTAACCCATAACCTGCATTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTGCGTCAGAGGGGGGTGGAATTCCACG0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTCGGTAAGTTAGAAGTGAAAGTCCTGTTTTCAAGGTGGGAATTGCTTTTAATACTGTCGGGCTTGAGTGCAGAAGAGGTAAGCGGAATTCCAAG0.333333
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGAAGAGGAAAGCGGAATTCCTAG0.333333
TTTTTCCCGCCCGGCGCATCAGTTCGATCTCGTGCTCGGATTTCAGGGTGATCATATATTCAGCACCCCAGAACCTTCAAGATCGCCTGTGTCGTCTCTTCCACAGTGGGATAGTCGTCCACAGTTTTCAGAATCCCCCGGGCCTCGTAG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCTGGAGTGAAAATGCGGGGCTTAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACCTTTAAGTCAGCTGTGAAATACGGCGGCTCAACCGTCGAACTGCAGTTGATACTGGAGGTCTTGAGTGCACACAAGGATACTGGAATTCATGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACAGCAAGTCTGATGTGAAAGCCCAGGGCCCAACCCCGGAACTGCATTGGAAACTGTTGGGCTTGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.333333
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGCGTGTGTAGGCGGTTTTTTAAGTCTGTGGTCTAAGCCTGGAGCTCAACTCCAGTTCGCCATGGAAACTGAAAAACTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.285714

Annotations:

common ontology terms
term enrichment score
TermScore
myanmar0.600000
karen0.600000
hmong0.333333
LOWER IN myanmar0.333333
LOWER IN karen0.333333
LOWER IN hmong0.333333
thailand0.285714
rural community0.153846
female0.030769
adult0.011429
china0.011364
LOWER IN china0.011364
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
myanmar0.500000
karen0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN hmong0.500000
thailand0.166667
rural community0.090909
female0.015873
china0.005814
LOWER IN china0.005814
adult0.005780
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
thailand1.000000
myanmar0.750000
karen0.750000
female0.500000
adult0.500000
rural community0.500000
hmong0.250000
china0.250000
LOWER IN myanmar0.250000
LOWER IN karen0.250000
LOWER IN hmong0.250000
LOWER IN china0.250000

Problems / suggestions? Please email info AT dbbact DOT org