Summary for ontology term: kingdom of denmark

Number of annotations with term: 50

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaCTAAGAATCTTGCGCAATGGGCGAAAGCCTGACGCAGCAATTCCGCGTGGGGGACGAAGGCCCTCGGGTCGTAAACCCCTTTTACGAGGGAAGAAGTTCTGACGGTACCTCGTGAATAAGACACGGCTAACTACGTGCCAGCAGCCGCGG0.305556
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraGCGCGAAACCTCTGCAATAGGCGAAAGCCTGACAGGGTTACTCTGAGTGACTTTCGCTAAGAAAGTCTTTTGACACCTCTAAAAATGGTGTAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTG0.305556
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Glycomycetaceae;g__GlycomycesTGGGGAATTTTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCTTTCGGGTTGTAAACCTCTTTTATCCACCACGAAGGCTCCGTATTCGCGGGGTTGACGGTAGTGGTTGAATAAGCGCCGGCTAACTACG0.290323
d__Bacteria;p__"Verrucomicrobia";c__Spartobacteria;g__Spartobacteria_genera_incertae_sedisTCGAGAATTTTTGACAATGGGGGAAACCCTGATCGAGCGACGCCGCGTGGAGGATGAAGGTCTTCGGATTGTAAACTCCTGTCATTTGGGAACAAGGTGCACACGTTAACTGCGTGCGTATTGATAGTACCAGAAGAGGAAGAGACGGCT0.244444
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterGCGCGAAACCTCCACAATGTGAGAAATCGCGATGGGGGAATCCCAAGTGCCATTCTTAACGGGATGGCTTTTCTTAAGTGTAAAGAGCTTTTGGAATAAGAGCTGGGCAAGACCGGTGCCAGCCGCCGCGGTAACACCGGCAGCTCTAGT0.237288
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGCGAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATGCGGGAATAAAGTCAGGTACGTGTACCTGTTTGTATGTACCGCATGAATAAGGACCGGCTAATT0.237288
d__Bacteria;p__Ignavibacteriae;c__Ignavibacteria;o__Ignavibacteriales;f__Ignavibacteriaceae;g__IgnavibacteriumTGAGGAATATTGGGCAATGCCCGCAAGGGTGACCCAGCAACGCCGCGTGGAGGATGAATGCCGTAAGGTTGTAAACTCCTGTTAGAGGGGAAGAACAATCCCGATAAAATCGGGATCTGACTGTACCCTCAGAGAAAGCCCCGGCTAACT0.237288
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGCGCAATGGAGGCAACTCTGACGCAGCCATGCCGCGTGCAGGAAGAAGGCGCTACGCGTTGTAAACTGCTTTTATCAGGGAAGAAACCCCTCGACGTGTCGAGGGTTGACGGTACCTGAGGAATAAGCACCGGCTAACT0.237288
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTAGGGAATATTGGTCAATGGATGCAAGTCTGAACCAGCCATGCCGCGTGCAGGAAGACGGCCTTCTGGGTTGTAAACTGCTTTTGCCAGGGGATAAAAGGCCCATGCGTGGGACATTGAAGGTACCTGGTGAATAAGCCACGGCTAACTA0.237288
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTAGGGAATATTGGTCAATGGATGGAAGTCTGAACCAGCCATGCCGCGTGCAGGAAGAAGGCCTTCTGGGTTGTAAACTGCTTTTGCCAGGGGCTAAAAGGCCGGTGCGCCGGAAATTGAAAGTACCTGGTGAATAAGCCACGGCTAACTA0.237288

Annotations:

common ontology terms
term enrichment score
TermScore
kingdom of denmark1.000000
lund0.390244
clayey till0.390244
late weichselian glaciation0.390244
loam soil0.326531
agricultural field0.252427
1-month-old human stage0.216216
wheat0.200000
ph 70.200000
hypopharynx0.137931
high biochar0.137931
LOWER IN 1-month-old human stage0.129032
metabolic syndrome0.129032
triticum aestivum0.125000
infant0.120690
age0.106195
age 1 week0.074074
depth 450-480cm0.074074
depth 550-600cm0.074074
LOWER IN depth 200-350cm0.074074
depth 200-350cm0.074074
age one week0.074074
orchesella cincta0.074074
springtail0.074074
plough layer 0.074074
depth 70-120cm0.074074
sandy till 0.074074
depth 200-260cm0.074074
depth 300-350cm0.074074
low biochar0.074074
straw0.074074
pycnoscelus surinamensis0.074074
cockroach0.074074
burrowing cockroach0.074074
depth (soil) 20-30cm0.068966
hindgut0.068966
1-year-old human stage0.063158
body proper0.055556
human adult stage0.042553
LOWER IN age one week0.038462
depth 20-120cm0.038462
LOWER IN depth 20-120cm0.038462
LOWER IN depth 450-600cm0.038462
depth 450-600cm0.038462
high arabinoxylan and resistant starch diet0.038462
LOWER IN high arabinoxylan and resistant starch diet0.038462
LOWER IN arabinoxylan diet0.038462
soil unamended with straw0.038462
LOWER IN soil amended with straw0.038462
soil amended with straw0.038462
LOWER IN soil unamended with straw0.038462
plant fiber cell0.037736
LOWER IN plant fiber cell0.037736
LOWER IN age 1 week0.037037
high fiber0.035714
LOWER IN high fiber0.035714
3-month-old human stage0.035088
LOWER IN 3-month-old human stage0.035088
digestive system0.031746
LOWER IN control diet0.031250
control diet0.031250
LOWER IN 1-year-old human stage0.030769
homo sapiens0.028470
adult0.021090
soil0.019231
feces0.018554
research facility0.011628
Fraction of dbbact annotations with this term covered by the query
TermScore
kingdom of denmark1.000000
age 1 week0.500000
LOWER IN age one week0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
depth 450-480cm0.500000
depth 550-600cm0.500000
depth 20-120cm0.500000
LOWER IN depth 200-350cm0.500000
depth 200-350cm0.500000
LOWER IN depth 20-120cm0.500000
LOWER IN depth 450-600cm0.500000
depth 450-600cm0.500000
age one week0.500000
orchesella cincta0.500000
springtail0.500000
hypopharynx0.500000
plough layer 0.500000
depth 70-120cm0.500000
sandy till 0.500000
depth 200-260cm0.500000
depth 300-350cm0.500000
high biochar0.500000
high arabinoxylan and resistant starch diet0.500000
low biochar0.500000
straw0.500000
LOWER IN high arabinoxylan and resistant starch diet0.500000
LOWER IN arabinoxylan diet0.500000
soil unamended with straw0.500000
LOWER IN soil amended with straw0.500000
soil amended with straw0.500000
LOWER IN soil unamended with straw0.500000
pycnoscelus surinamensis0.500000
cockroach0.500000
burrowing cockroach0.500000
1-month-old human stage0.333333
LOWER IN 1-month-old human stage0.333333
loam soil0.333333
metabolic syndrome0.333333
plant fiber cell0.333333
LOWER IN plant fiber cell0.333333
LOWER IN age 1 week0.250000
depth (soil) 20-30cm0.250000
hindgut0.250000
wheat0.200000
ph 70.200000
agricultural field0.166667
high fiber0.166667
LOWER IN high fiber0.166667
3-month-old human stage0.142857
LOWER IN 3-month-old human stage0.142857
age0.095238
body proper0.090909
triticum aestivum0.090909
infant0.076923
LOWER IN control diet0.071429
control diet0.071429
1-year-old human stage0.066667
LOWER IN 1-year-old human stage0.066667
human adult stage0.045455
digestive system0.026316
homo sapiens0.014760
adult0.011561
soil0.010101
feces0.009554
research facility0.006803
Fraction of annotations for the query sequences containing the term
TermScore
kingdom of denmark1.000000
agricultural field0.520000
homo sapiens0.400000
feces0.320000
lund0.320000
loam soil0.320000
clayey till0.320000
late weichselian glaciation0.320000
infant0.280000
soil0.200000
triticum aestivum0.200000
wheat0.200000
ph 70.200000
1-month-old human stage0.160000
age0.120000
adult0.120000
LOWER IN 1-month-old human stage0.080000
hypopharynx0.080000
metabolic syndrome0.080000
high biochar0.080000
1-year-old human stage0.060000
age 1 week0.040000
depth 450-480cm0.040000
depth 550-600cm0.040000
LOWER IN depth 200-350cm0.040000
depth 200-350cm0.040000
age one week0.040000
body proper0.040000
orchesella cincta0.040000
springtail0.040000
depth (soil) 20-30cm0.040000
plough layer 0.040000
depth 70-120cm0.040000
sandy till 0.040000
depth 200-260cm0.040000
depth 300-350cm0.040000
low biochar0.040000
straw0.040000
digestive system0.040000
research facility0.040000
hindgut0.040000
pycnoscelus surinamensis0.040000
cockroach0.040000
burrowing cockroach0.040000
human adult stage0.040000
LOWER IN age one week0.020000
depth 20-120cm0.020000
LOWER IN depth 20-120cm0.020000
LOWER IN depth 450-600cm0.020000
depth 450-600cm0.020000
LOWER IN 1-year-old human stage0.020000
3-month-old human stage0.020000
LOWER IN age 1 week0.020000
LOWER IN 3-month-old human stage0.020000
high fiber0.020000
plant fiber cell0.020000
high arabinoxylan and resistant starch diet0.020000
LOWER IN control diet0.020000
control diet0.020000
LOWER IN high fiber0.020000
LOWER IN plant fiber cell0.020000
LOWER IN high arabinoxylan and resistant starch diet0.020000
LOWER IN arabinoxylan diet0.020000
soil unamended with straw0.020000
LOWER IN soil amended with straw0.020000
soil amended with straw0.020000
LOWER IN soil unamended with straw0.020000
Exp. ID User ID Description Date Region Flag Sequences
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in high fiber plant fiber cell high arabinoxylan and resistant starch diet compared to control diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 1
827sheryoDominant in soil at 25cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 3
827sheryoDominant in soil at 95cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 4
364amnondominant body proper, orchesella cincta, kingdom of denmark, springtail2018-08-29v4No1 / 7
827sheryoDominant in soil at 325cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 7
610sheryoDominant in agricultural field soil (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 8
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar, low biochar)2020-04-21v3No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high fiber plant fiber cell high arabinoxylan and resistant starch diet arabinoxylan diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 9
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw, high biochar)2020-04-21v3No1 / 10
827sheryoDominant in soil at 575cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 12
827sheryoDominant in soil at 465cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 13
48amnondominant homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 13
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
827sheryoDominant in soil at 230cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 15
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
283amnondominant digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 17
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
880amnondominant feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 18
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
610sheryoHigher in agricultural field soil unamended with straw ( high in soil unamended with straw compared to soil amended with straw in soil triticum aestivum kingdom of denmark wheat ph 7 agricultural field )2020-04-21v3No1 / 22
364amnoncommon body proper, orchesella cincta, kingdom of denmark, springtail2018-08-29v4No1 / 30
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in soil triticum aestivum kingdom of denmark wheat ph 7 agricultural field )2020-04-21v3No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
880amnoncommon feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 79
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 129
827sheryoHigher in soil depth of 465cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 450-600cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 137
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 197
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 318
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
283amnoncommon digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 448
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142

Problems / suggestions? Please email info AT dbbact DOT org