Summary for ontology term: kingdom of norway

Number of annotations with term: 30

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.033333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.033333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.033333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.033333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.033333
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTAGTAGGTTTAAAGGGTACCTAGACGGTATAATTAGTCTTAAATAGGATACGGTTATACTAGAGTTATATCTGAGAAGGGGAGTATTCATGGAGTAGAGTTGAAATTCTTTGATACCATGAG0.033333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGGAATACCGCAGCTTAACTGCGGGGTTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.033333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTATGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.033333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__FinegoldiaTACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAATAAGTCGAATGTTAAAGATCGGGGCTCAACCCCGTAAAGCATTGGAAACTGATAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT0.033333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGCCCGCAGCTTAACTGCGGGACTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.033333

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__PedobacterTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGAGGTGAAAGACGGTAGCTCAACTATCGCAGTGCCTTTGATACTGATGGGCTTGAATAAACTAGAGGTAGGCGGAATGAGACA0.500000
d__BacteriaGACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTATATCAAGCCCCAAAAGGGAACGGATATTACTAGAGTTTTATGTGAGAGGTTTATTTTAGTACTATCGGAGTAGAGATGAAATTCTTTGATACT0.500000
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAAATTAATCTTAAATAGGATATGTTTTTACTAGAGTTATATACGAGGAGGTGAGTATTTATGGAGTAGAGTTGAAATTCGTTGATACCATAAC0.500000
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCTTAGTAGGGACTAATTTTCTAGAGTTTTATGTGTGAAGATCGAATGACCTGAAGAGCAATAAAATGCATTGATACAGGGAAGAC0.500000
d__BacteriaTACGTAAAAGACGAGTGTTATTCATCTTTAATCGGTTTAAAGGGTACCTAGACGGAAAATCAAGCTTAATTAAACTAAGGACTAGTTTTCTAGAGTTTGACATGAGAAGGTACGAACTATCAGAGGAGAGATAAAATTTGTTGATACTGG0.500000
d__BacteriaGACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTGGATCTTGCCCCTAAAAGGAACGGATCTTACTAGAGTTTTATGGAAGAGGTTAGATTTAGTATTAACGGTGGAGAGATGAAATTCTTTGATACT0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCATTCAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATTGCCTTCGATACTGTTTGGCTTGAGACCGGAAGAGGTAAGTGGAACTGCGAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGAGATATCAGTCAGATGTGAAATTCCTGGGCTTAACCTGGGGGCTGCATTTGAGACGGTATTTCTAGAGTGTGAAAGAGGGTCGTGGAATTCCCAG0.500000
d__BacteriaCACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCATAATAGGGACTAATTTTCTAGAGTTTTATGAGAGAAGGAGCGAATTACCGGTGGAGAGTTGATATTTTGTGATACCGGTAGGA0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCTTGTAAGTTGGGGGTGAAAGCCCGTGGCTCAACCACGGAATTGCCTTCGATACTGCTTGGCTTGAGTGTGGTAGAGGTTGGTGGAACTGCGAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__IntrasporangiaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGTGGTTTGTCGCGTCTGTTGTGAAATTTCGGGGCTCAACCCCGAACTTGCAGTGGATACGGGCAGACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.390244
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Xanthobacteraceae;g__PseudolabrysTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTCTTAAGTCGGTGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGAGAAGCTCGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.390244
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__SolirubrobacteralesTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGTGTAGGTGGCTCGGTAAGTCCGCTGTGAAAGTCCAGGGCTCAACCCTGGAATGCCGGTGGATACTGTCGAGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.324324
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGATTAAGTCGAATGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCATTCGATACTGATCGACTTGAAGGCAGGAGAGGGAAGTGGAATTCCCGG0.324324
d__Bacteria;p__"Verrucomicrobia";c__Spartobacteria;g__Spartobacteria_genera_incertae_sedisTACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGTGGCGCCGTTAGTCAGGTGTGAAATCTCGGGGCTTAACTCCGAAACTGCATTTGATACTGCGGTGCTTGAGGACTGGAGAGGAGACTGGAATTCATGG0.324324
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGTCAGATAGGTCCGTTGTGAAAACTCGAGGCTCAACCTCGAGACGCCGATGGAAACCATCTGACTAGAGTCCGGAAGAGGAGAGTGGAATTCCTGG0.277778
d__BacteriaTACGTACGAGGCGAGCGTTATCCGGAATTACTGGGCGTAAAGCGCGCGCAGGTGGCTTTTTAAGTAGGGCGTGAAATCTCCCGGCCTAACTGGGAGGGGTCGCCCTAGACTGGGGAGCTTGAGGCTGGCAGAGGTAGGTGGAATTCCTGG0.277778
d__Bacteria;p__"Actinobacteria"TACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGTGTAGGCGGTCCGATAAGTCGGTTGTGAAAGTCAAGGGCTCAACCCTTGAATGCCGACCGATACTGTCGGGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.270270
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTTGTAAGTCAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTTGATACTGCACGTCTCGAGTCCGGAAGAGGTGAGTGGAATTCCTAG0.270270
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCAAGTCAGTCGAATGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCATTCGATACTGCTCGACTTGAAGGCAGGAGAGGGAAGTGGAATTCCCGG0.270270

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
kingdom of norway0.875000
colon0.666667
LOWER IN colon0.666667
oslo0.500000
mouse strain o1290.500000
svalbard archipelago0.500000
permafrost active layer0.500000
depth 100-150cm0.500000
depth 150-200cm0.500000
permafrost transition layer0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
lapland0.500000
LOWER IN lapland0.500000
gadus morhua0.500000
atlantic cod0.500000
depth 0-5cm0.333333
age 1 year0.250000
permafrost0.250000
depth (soil) 20-30cm0.250000
LOWER IN depth (soil) 20-30cm0.250000
snow0.250000
LOWER IN age 1 year0.250000
finland0.142857
LOWER IN finland0.142857
LOWER IN fourth decade human stage0.142857
fourth decade human stage0.142857
LOWER IN kingdom of norway0.125000
LOWER IN state of colorado0.111111
state of colorado0.111111
sheep0.100000
ovis aries0.083333
sweden0.066667
LOWER IN sweden0.066667
fish0.066667
ileum0.062500
LOWER IN ileum0.062500
LOWER IN stomach0.058824
stomach0.058824
rumen0.050000
infant0.038462
LOWER IN infant0.038462
digestive system0.026316
depth (soil) 0-20cm0.025000
LOWER IN depth (soil) 0-20cm0.025000
mus musculus0.015873
soil0.010101
homo sapiens0.007380
feces0.006369
LOWER IN adult0.005780
adult0.005780
LOWER IN united states of america0.004049
united states of america0.004049
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
kingdom of norway0.966667
permafrost0.400000
soil0.400000
svalbard archipelago0.400000
homo sapiens0.266667
feces0.233333
oslo0.200000
depth (soil) 20-30cm0.133333
depth 0-5cm0.133333
snow0.133333
infant0.100000
age 1 year0.100000
depth (soil) 0-20cm0.100000
depth 100-150cm0.100000
depth 150-200cm0.100000
sweden0.100000
finland0.100000
lapland0.100000
adult0.100000
fourth decade human stage0.100000
colon0.066667
LOWER IN colon0.066667
mus musculus0.066667
mouse strain o1290.066667
permafrost active layer0.066667
LOWER IN depth (soil) 20-30cm0.066667
digestive system0.066667
gadus morhua0.066667
fish0.066667
atlantic cod0.066667
rumen0.066667
ovis aries0.066667
sheep0.066667
ileum0.033333
LOWER IN feces0.033333
LOWER IN ileum0.033333
LOWER IN stomach0.033333
stomach0.033333
permafrost transition layer0.033333
LOWER IN permafrost transition layer0.033333
LOWER IN depth (soil) 0-20cm0.033333
LOWER IN depth 100-150cm0.033333
LOWER IN depth 150-200cm0.033333
LOWER IN united states of america0.033333
LOWER IN state of colorado0.033333
united states of america0.033333
state of colorado0.033333
LOWER IN kingdom of norway0.033333
LOWER IN sweden0.033333
LOWER IN finland0.033333
LOWER IN lapland0.033333
LOWER IN adult0.033333
LOWER IN fourth decade human stage0.033333
LOWER IN infant0.033333
LOWER IN age 1 year0.033333
Exp. ID User ID Description Date Region Flag Sequences
329amnondominant rumen, ovis aries, kingdom of norway, sheep2018-05-13v4No1 / 4
347amnondominant permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 6
347amnondominant permafrost, soil, kingdom of norway, svalbard archipelago, depth 150-200cm2018-07-15v4No1 / 6
268amnondominant digestive system, gadus morhua, kingdom of norway, fish, atlantic cod2017-12-24v4No1 / 7
347amnondominant permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 10
347amnondominant permafrost, soil, kingdom of norway, svalbard archipelago, permafrost active layer, depth (soil) 0-20cm2018-07-15v4No1 / 11
511amnondominant kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 15
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
511amnon high in united states of america state of colorado compared to kingdom of norway sweden finland lapland in depth 0-5cm snow 2019-03-20v4No1 / 24
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
268amnoncommon digestive system, gadus morhua, kingdom of norway, fish, atlantic cod2017-12-24v4No1 / 44
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
8amnon high in stomach compared to colon in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 68
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 150-200cm2018-07-15v4No1 / 126
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
8amnon high in colon compared to stomach in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 132
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 173
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 221
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, permafrost active layer, depth (soil) 0-20cm2018-07-15v4No1 / 405
347amnon high in permafrost transition layer depth (soil) 0-20cm compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 477
329amnoncommon rumen, ovis aries, kingdom of norway, sheep2018-05-13v4No1 / 506
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
347amnon high in depth (soil) 20-30cm compared to permafrost transition layer depth (soil) 0-20cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 788
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 1080

Problems / suggestions? Please email info AT dbbact DOT org