Summary for ontology term: kingdom of spain

Number of annotations with term: 125

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.008065
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGACACTTTTCGGAGCGTAAACTCCTTTTGTTAGGGAAGAACAATGACGGTACCTAACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGT0.008065
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.008065
TTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTGTGGCGTACGGTGTGTTCCGGGCACTTGTTGTCTGAGTAACCTGCTGTTGCCATCCTTGGGTGGAACCTGTGTGGCATTAGGTTGTCGTGC0.008065
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGACGGCCTTCGGGTTGTAAAGCTCTGTTATACGGGACGAACGGGCGGGATGCTAATACCATCCTGTTGTGACGGTACCGTAAGAGAAAGCCACGG0.008065
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGACGAAGTAAGTGACGGTACCAACAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGC0.008065
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTAGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGAGGGGAGGAGAATGACGTTACCCTCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.008065
d__BacteriaTGAGGAATATTGGGCAATGGAGGCAACTCTGACCCAGCCATGCCGCGTGAGTGAAGAAGGTTTTCGGATTGTAAAGCTCTTTCGGACAGGAAGATAATGACGGTACTGTCTAAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.008065
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGCAGGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGTATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.008065
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCCTTCGGGTTGTAAAACTCTGTTGTCAGGGACGAAAGCACCGATCTATAATACATTTTGGTGTTGACGGTACCTGACGAGGAAGCCACGG0.008065

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACGGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.333333
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTCCAAAACTCCCAGTCTTGAGTTCGAGAGAGGTGAGTGGAACTCCGAG0.333333
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeCACGTACTGTGCGAACGTTATTCGGAATCACTGGGCTTAAAGGGTATGTAGGCGGTTAATCAAGTCAGATGTGAAATGCCACAGCTCAACTGTGGCACTGCGTTTGAAACTGATTGGCTAGAGTATTCCAGAGGTATGCGGAACTGCCAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAAGGAAGACGGTTTTCGGATTGTAAACTTCTGTTCTTAGTGAAGAATAATGACGGTAGCTAAGGAGCAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTGGGGAATCTTGCGCAATGGGCGGAAGCCTGACGCAGCGACGCCGCGTGCGGGAGGAAGGCCCTCGGGTCGTAAACCGCTTTCAGCAGGGACGAGGCCGCAAGGTGACGGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGC0.333333
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Cryomorphaceae;g__CrocinitomixTACGGAGGGTCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTTCGCAGGCGGTCAATTAAGTCAGTGGTGAAATCTCGGGGCTCAACTCCGAAACTGCCATTGATACTGATTGACTTGAATTAAGTTGGAGTAGGCGGAATGTGTAG0.333333
d__BacteriaGACAGAGGGTGCGAACGTTGCTCGGAATCACTGGGCGTAAAGCGCGTGTAGGCGGACTGATAAGTCGGGTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGCCAGTCTTGAGTGTCGGAGAGGGAAGTGGAATTGCTGG0.333333
d__BacteriaTACGAGGGGTGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGCGGGTGTAGGTGGTCATATAAGTCAGAAGTGAAAGCCCAGGGCTCAACCTTGGAAGTGCTTTTGATACTGTATGACTTGAGTGTAAGAGAGGTTACTAGAATTCCTGG0.333333
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTAGGGAATTTTCGTCAATGGGGGGAACCCTGAACGAGCAATGCCGCGTGAGTGAGGAAGGTCTTCGGATCGTAAAGCTCTGTTGTAAGAGAAAAACGGCACTCATAGGGAATGATGAGTGAGTGATGGTATCTTACCAGAAAGTCACGGC0.333333
d__BacteriaTGAGGGATATTGGGCAATGGGGGAAACCCTGACCCAGCAACGCCGCGTGAGGGATGACGGTTTTCGGATTGTAAACCTCTGTCCTCTGTGAAGATAGTGACGGTAGCAGAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.176101
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCGGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTGGAAACTGCCATGCTGGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGAAGCAAGTCTGGAGTGAAAACCCGGGGCTTAACCCCGGGATTGCTTTGGAAACTGTTTAACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.162500
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTTATCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.158940
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCCGGCAAGTCAGATGTGAAATCTGGAGGCTTAACCTCCAAACTGCATTTGAAACTGTTGGTCTTGAGTACCGGAGAGGTTATCGGAATTCCTTG0.155844
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAATGCAAGTCTGGAGTGAAAACCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATAACTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.152778
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGGAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.150289
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGCAGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.150289
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTATGCAAGTTGGGAGTGAAATACATGGGCTCAACCCATGAACTGCTCTCAAAACTGTGTATCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.150000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTCTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.143791

Annotations:

common ontology terms
term enrichment score
TermScore
kingdom of spain0.967932
free range chicken0.172185
pyrenees0.137931
hiv infection0.129730
age 13-15 years0.125874
air0.121827
14-year-old human stage0.118421
madrid0.116788
biofilm0.114833
la rioja province0.113475
13-year-old human stage0.111801
gay0.111801
male0.106312
tick0.101911
homosexual0.100559
msm0.100559
broiler chicken0.095745
chicken0.092243
adult0.091856
bile0.091603
gallus gallus0.088176
estuary water0.087591
bilbao0.087591
municipality of logrono0.087591
gallbladder0.087591
sweden0.081250
estuary0.080537
whole body0.078049
oral cavity0.075472
homo sapiens0.075303
body proper0.075117
supragingival dental plaque0.071856
heterosexual0.066667
msw0.066667
supragingival plaque0.064865
river0.060914
control0.060592
age 3 weeks0.056738
age 6 weeks0.055172
farm0.047983
caecum0.047983
feces0.047364
black dental staining0.045802
salinity <5 ppt0.045802
salinity >20 ppt0.045802
sand0.045802
epilithic0.045802
irritable bowel syndrome0.045802
antiretroviral therapy0.045802
cholelithiasis0.045802
autumn0.045198
LOWER IN control0.045161
human immunodeficiency virus infectious disease0.044776
rock0.040268
child0.040089
tooth disease0.036585
infant0.034934
saliva0.034188
winter0.034091
spring0.031496
4-month-old human stage0.031008
isla de salvora0.031008
age 8 days0.031008
larus michahellis0.031008
gull0.031008
haemaphysalis punctata0.031008
red sheep tick0.031008
dermacentor marginatus0.031008
ornate sheep tick0.031008
rhipicephalus sanguineus0.031008
brown dog tick0.031008
valladolid0.031008
harbor0.031008
clavelina oblonga0.031008
sea squirts0.031008
inner tunic0.031008
municipality of reus0.031008
age 3 days0.031008
age 4 days0.031008
age 12 weeks0.031008
summer0.030928
orchard0.030534
ixodes ricinus0.030534
age 2 weeks0.030534
citrus0.030075
clostridium difficile infection0.030075
age 8 weeks0.030075
6-month-old human stage0.029630
LOWER IN hiv infection0.029630
age 4 weeks0.029630
clostridium difficile intestinal infectious disease0.029197
breast milk0.028777
cultivated environment0.028369
fresh water0.028302
hospital0.027586
LOWER IN kingdom of spain0.027397
bird0.026490
water0.026374
LOWER IN male0.025316
city0.024242
Fraction of dbbact annotations with this term covered by the query
TermScore
spring1.000000
bile1.000000
kingdom of spain0.952381
madrid0.666667
4-month-old human stage0.500000
black dental staining0.500000
LOWER IN black dental staining0.500000
LOWER IN braces0.500000
LOWER IN teeth braces0.500000
age 13-15 years0.500000
braces0.500000
teeth braces0.500000
diet without sweets0.500000
LOWER IN diet containing sweets0.500000
diet containing sweets0.500000
LOWER IN diet without sweets0.500000
LOWER IN age 13-15 years0.500000
pyrenees0.500000
salinity <5 ppt0.500000
LOWER IN salinity &gt;20 ppt0.500000
estuary water0.500000
bilbao0.500000
salinity >20 ppt0.500000
LOWER IN salinity &lt;5 ppt0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
sand0.500000
epipsammic0.500000
LOWER IN epilithic0.500000
epilithic0.500000
LOWER IN sand0.500000
LOWER IN epipsammic0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
la rioja province0.500000
haemaphysalis punctata0.500000
red sheep tick0.500000
dermacentor marginatus0.500000
ornate sheep tick0.500000
rhipicephalus sanguineus0.500000
brown dog tick0.500000
valladolid0.500000
harbor0.500000
clavelina oblonga0.500000
sea squirts0.500000
inner tunic0.500000
municipality of reus0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
age 3 days0.500000
free range chicken0.500000
age 4 days0.500000
age 12 weeks0.500000
LOWER IN typhlitis0.500000
typhlitis0.500000
LOWER IN free range chicken0.500000
cholelithiasis0.500000
gallbladder0.500000
LOWER IN cholelithiasis0.500000
orchard0.333333
14-year-old human stage0.333333
LOWER IN 14-year-old human stage0.333333
LOWER IN sedentary0.333333
LOWER IN low physical activity0.333333
sedentary0.333333
low physical activity0.333333
ixodes ricinus0.333333
LOWER IN human immunodeficiency virus infectious disease0.333333
human immunodeficiency virus infectious disease0.333333
age 2 weeks0.333333
citrus0.250000
13-year-old human stage0.250000
LOWER IN 13-year-old human stage0.250000
estuary0.250000
tick0.250000
clostridium difficile infection0.250000
gay0.250000
LOWER IN gay0.250000
age 3 weeks0.250000
age 8 weeks0.250000
6-month-old human stage0.200000
high physical activity0.200000
LOWER IN high physical activity0.200000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
hiv infection0.200000
heterosexual0.200000
msw0.200000
LOWER IN hiv infection0.200000
age 4 weeks0.200000
age 6 weeks0.200000
air0.166667
clostridium difficile intestinal infectious disease0.166667
homosexual0.166667
msm0.166667
LOWER IN homosexual0.166667
LOWER IN msm0.166667
Fraction of annotations for the query sequences containing the term
TermScore
kingdom of spain0.984000
homo sapiens0.520000
adult0.392000
feces0.336000
farm0.176000
caecum0.176000
gallus gallus0.176000
chicken0.176000
control0.152000
male0.128000
sweden0.104000
free range chicken0.104000
air0.096000
biofilm0.096000
hiv infection0.096000
saliva0.080000
oral cavity0.080000
pyrenees0.080000
child0.072000
age 13-15 years0.072000
13-year-old human stage0.072000
14-year-old human stage0.072000
gay0.072000
homosexual0.072000
msm0.072000
broiler chicken0.072000
madrid0.064000
body proper0.064000
whole body0.064000
tick0.064000
la rioja province0.064000
LOWER IN control0.056000
supragingival plaque0.048000
supragingival dental plaque0.048000
estuary0.048000
water0.048000
estuary water0.048000
bilbao0.048000
river0.048000
municipality of logrono0.048000
bile0.048000
gallbladder0.048000
heterosexual0.040000
msw0.040000
infant0.032000
autumn0.032000
age 6 weeks0.032000
age 3 weeks0.032000
tooth disease0.024000
black dental staining0.024000
winter0.024000
summer0.024000
fresh water0.024000
salinity <5 ppt0.024000
saline water0.024000
salinity >20 ppt0.024000
sand0.024000
rock0.024000
epilithic0.024000
irritable bowel syndrome0.024000
human immunodeficiency virus infectious disease0.024000
antiretroviral therapy0.024000
cholelithiasis0.024000
orchard0.016000
soil0.016000
rhizosphere0.016000
citrus0.016000
cultivated environment0.016000
6-month-old human stage0.016000
4-month-old human stage0.016000
city0.016000
LOWER IN female0.016000
female0.016000
LOWER IN male0.016000
spring0.016000
breast milk0.016000
isla de salvora0.016000
bird0.016000
age 8 days0.016000
larus michahellis0.016000
gull0.016000
sediment0.016000
ixodes ricinus0.016000
haemaphysalis punctata0.016000
red sheep tick0.016000
dermacentor marginatus0.016000
ornate sheep tick0.016000
rhipicephalus sanguineus0.016000
brown dog tick0.016000
hospital0.016000
clostridium difficile intestinal infectious disease0.016000
clostridium difficile infection0.016000
valladolid0.016000
LOWER IN kingdom of spain0.016000
LOWER IN hiv infection0.016000
harbor0.016000
clavelina oblonga0.016000
sea squirts0.016000
inner tunic0.016000
municipality of reus0.016000
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 1
727amnondominant body proper, kingdom of spain, whole body, tick, la rioja province, haemaphysalis punctata, red sheep tick2021-01-03v3No1 / 2
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 3
252amnonhigh freq. in river sand biofilm (dominant river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 3
727amnondominant body proper, kingdom of spain, whole body, tick, la rioja province, dermacentor marginatus, ornate sheep tick2021-01-03v3No1 / 3
727amnondominant body proper, kingdom of spain, whole body, tick, la rioja province, rhipicephalus sanguineus, brown dog tick2021-01-03v3No1 / 3
682amnondominant city, air, kingdom of spain, madrid2028-03-04v3No1 / 4
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 4
598amnon high in male compared to female in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
598amnon high in female compared to male in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 5
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 6
727amnoncommon body proper, kingdom of spain, whole body, tick, la rioja province, rhipicephalus sanguineus, brown dog tick2021-01-03v3No1 / 7
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
252amnonhigh freq. in river rock biofilm (dominant river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 8
727amnoncommon body proper, kingdom of spain, whole body, tick, la rioja province, haemaphysalis punctata, red sheep tick2021-01-03v3No1 / 8
415amnondominant orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 9
678amnon high in tooth disease black dental staining compared to control in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 9
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
727amnoncommon body proper, kingdom of spain, whole body, tick, la rioja province, dermacentor marginatus, ornate sheep tick2021-01-03v3No1 / 10
848amnoncommon feces, homo sapiens, infant, kingdom of spain, 4-month-old human stage2021-12-13v1No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to braces teeth braces in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 11
403amnondominant air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 11
510amnondominant estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 12
381amnoncommon feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 12
727amnondominant body proper, kingdom of spain, whole body, tick, la rioja province, ixodes ricinus2021-01-03v3No1 / 12
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 3 days2019-03-03v4No1 / 12
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
598amnonprobable contaminant (collection date dependent) (contamination)2020-03-25v3No1 / 14
403amnondominant air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 14
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 16
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 17
381amnondominant feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 17
848amnoncommon feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 18
403amnondominant air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 18
630amnon high in sedentary low physical activity compared to high physical activity in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 18
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 18
678amnondominant homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 19
510amnondominant estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 20
848amnondominant feces, homo sapiens, infant, kingdom of spain, 4-month-old human stage2021-12-13v1No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
794amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 21
403amnondominant air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
848amnondominant feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 25
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 27
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 27
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 28
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 32
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
598amnonhigher in mouthwash of students compared to teachers ( high in child age 13-15 years 13-year-old human stage 14-year-old human stage compared to adult in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 56
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
403amnon high in summer compared to winter in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 67
727amnoncommon body proper, kingdom of spain, whole body, tick, la rioja province, ixodes ricinus2021-01-03v3No1 / 69
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
678amnon high in control compared to tooth disease black dental staining in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 81
495amnon high in broiler chicken compared to free range chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 90
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 121
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 124
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 134
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
510amnoncommon estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 185
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
495amnon high in free range chicken compared to broiler chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 199
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 214
699amnon high in kingdom of spain mediterranean sea italy compared to united states of america atlantic ocean brazil in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 216
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 223
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 236
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
699amnon high in united states of america atlantic ocean brazil compared to kingdom of spain mediterranean sea italy in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 317
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 374
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 412
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org