Summary for ontology term: lapland

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGGAATACCGCAGCTTAACTGCGGGGTTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.250000
d__BacteriaTACAAGGGAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACTGTATATCTTGCCTGCGAGGGAACGGATATGACTAGAGTTTTATGTGGGAGGTAAATATTAGTACTACTAGTGTAGAGATGAAATTCTTTGATACTT0.250000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__GranulicellaTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGTTTGACAAGTCATCTGTGAAATCTCTGGGCTCAACCCAGAGTCTGCAGGCGAAACTGTCGGGCTTGAGTATTGGAGAGGTGAGTGGAATTTCCGG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTATGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__BacteriaGACGGAGAGCGCGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGTAGTTTTTGATAATTTTTAACTAAAAACGCAGAGTGTTCCTATGCGCTAGTTTTTTTAAAGATCAAACTAGTACTGATTAGAGGTTGGGGCAATTTCC0.250000
d__BacteriaCACGGAGAGCACGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGCTGCTGTTGTTAATTTTTAACCGAAATCGCGGAGTGTTCCTATGCGCTGGTTTTTTAGAAGATATAGCTGGTGTTAAAGATAGGTTGGGGCAATTTCC0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCTATAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGTGGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.500000
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAAATTAATCTTAAATAGGATATGTTTTTACTAGAGTTATATACGAGGAGGTGAGTATTTATGGAGTAGAGTTGAAATTCGTTGATACCATAAC0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGAGATATCAGTCAGATGTGAAATTCCTGGGCTTAACCTGGGGGCTGCATTTGAGACGGTATTTCTAGAGTGTGAAAGAGGGTCGTGGAATTCCCAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGAGCGTAGGCGGGCATGTAAGTCAGTGGTGAAATCTTGGGGCTCAACCCCGAAACTGCCATTGATACTATGTGCCTTGGATCCTGTTGAGGTTTGCGGAATATGTCA0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__PedobacterTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGAGGTGAAAGACGGTAGCTCAACTATCGCAGTGCCTTTGATACTGATGGGCTTGAATAAACTAGAGGTAGGCGGAATGAGACA0.500000
d__BacteriaCACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCATAATAGGGACTAATTTTCTAGAGTTTTATGAGAGAAGGAGCGAATTACCGGTGGAGAGTTGATATTTTGTGATACCGGTAGGA0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTTTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGATGAAGACTGCAAGGCTTGAATCTGGCAGAGGGGGGTAGAATTCCACG0.500000
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACGGGAAATCAAGCCATAGTAGGGACTAATTTTCTAGAGTTTTATGTGTGAAGATCGAATTACCTGAAGAGCAATAAAATGCATTGACACAGGGAAGAC0.500000
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCTTAGTAGGGACTAATTTTCTAGAGTTTTATGTGTGAAGATCGAATGACCTGAAGAGCAATAAAATGCATTGATACAGGGAAGAC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTTTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGATGAAGACTGCAAGGCTTGAATCTGGCAGAGGGGGGGAGAATTCCACG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaCACGGAGAGCACGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGCTGCTGTTGTTAATTTTTAACCGAAATCGCGGAGTGTTCCTATGCGCTGGTTTTTTAGAAGATATAGCTGGTGTTAAAGATAGGTTGGGGCAATTTCC0.750000
d__BacteriaGACGGAGAGCGCGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGTAGTTTTTGATAATTTTTAACTAAAAACGCAGAGTGTTCCTATGCGCTAGTTTTTTTAAAGATCAAACTAGTACTGATTAGAGGTTGGGGCAATTTCC0.666667
d__BacteriaAACGTGGGAGGCAAGCGTTATTGATCTTAAATGGGTCTAAAGGGTCCGTAAAACTGTAAATTAAGCGAGTATTTAAATTACTATCGAACTGATTTACTAGAGTCTTATAGAGGAACAGAGGAATTGCAAGAGTAAGGATGAAATCTTTTG0.571429
d__BacteriaGACAGAGGGGGAAAGTGTTGAGCATCTGGACTAGGCCTAAAGCGCGGGTCGGTGGTTTGATAAGCTTTAAAATATTCCTCCGAAGGATCGGAGCTTTTTTTAAAGACTCTTGAACTGGAGTTTCAACCCAGGGTAAGAGAACAACCCAAG0.571429
TACGAGGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTATATCTAGCCCTAAAAGGGAACAGATTTACTAGAGTTTTATGTAAGAGGAAAATTTAGTACTATTGGAGTAGAGATGAAATTCTTTGATACTAA0.571429
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTGTACAGTCAGATGTGAAATTCCCGGGCTTAACCTGGGGACTGCATTTGATACGTGCGGGCTAGAGTGTGAAAGAGGGTCGTGGAATTCCCAG0.444444
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTTTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAATGGCATTTGTGACTGGAAGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.400000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__GranulicellaTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGTTTGACAAGTCATCTGTGAAATCTCTGGGCTCAACCCAGAGTCTGCAGGCGAAACTGTCGGGCTTGAGTATTGGAGAGGTGAGTGGAATTTCCGG0.400000
d__BacteriaTACAAGGGAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTGTATCTAGCCTGCGAGGGAACGGATACGACTAGAGTTTTATGTGGGAGGTAAATATCGTACTATGTGTGTAGAGATGAAATTCTTTGATAATAC0.363636
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTAGTAGGTTTAAAGGGTACCTAGACGGTATAATTAGTCTTAAATAGGATACGGTTATACTAGAGTTATATCTGAGAAGGGGAGTATTCATGGAGTAGAGTTGAAATTCTTTGATACCATGAG0.363636

Annotations:

common ontology terms
term enrichment score
TermScore
lapland0.600000
depth 0-5cm0.500000
snow0.400000
LOWER IN lapland0.333333
finland0.240000
kingdom of norway0.214286
LOWER IN finland0.181818
LOWER IN kingdom of norway0.166667
LOWER IN state of colorado0.153846
state of colorado0.153846
sweden0.122449
LOWER IN sweden0.105263
LOWER IN united states of america0.007968
united states of america0.007968
Fraction of dbbact annotations with this term covered by the query
TermScore
lapland0.500000
LOWER IN lapland0.500000
depth 0-5cm0.333333
snow0.250000
finland0.142857
LOWER IN finland0.142857
kingdom of norway0.125000
LOWER IN kingdom of norway0.125000
LOWER IN state of colorado0.111111
state of colorado0.111111
sweden0.066667
LOWER IN sweden0.066667
LOWER IN united states of america0.004049
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
depth 0-5cm1.000000
snow1.000000
kingdom of norway0.750000
sweden0.750000
finland0.750000
lapland0.750000
LOWER IN united states of america0.250000
LOWER IN state of colorado0.250000
united states of america0.250000
state of colorado0.250000
LOWER IN kingdom of norway0.250000
LOWER IN sweden0.250000
LOWER IN finland0.250000
LOWER IN lapland0.250000

Problems / suggestions? Please email info AT dbbact DOT org