Summary for ontology term: leaf surface

Number of annotations with term: 18

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.117647
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.117647
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGTGTAGGTGGCTCATTAAGTCACATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATGTGATACTGGTGGTGCTAGAATATGTGAGAGGGAAGTAGAATTCCAG0.117647
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGTCTGGCTAGAGTGCGGTAGAGGGTAGTGGAATTTCCAG0.117647
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGCATGGCTTGAATCCAGGAGAGGTGAGTGGAATTCCGAG0.117647
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__PantoeaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTTAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGCAGGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.117647
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGCGGCTAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG0.117647

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCATCTAAGTCAGACGTGAAATCCCCCGGCTTAACCTGGGAACTGCGTCTGATACTGGACGGCTCGAGTTTGGGAGAGGGATGCAGAATTCCAGG0.333333
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCTTGGCAAGTCCGCTGTGAAAACTCGAGGCTTAACCTCGAGACGTCGGTGGAAACTGCCTGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCTGG0.333333
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTTGCAAGCCAGAGGTGAAATGCCTGAGCTCAACTTAGGAATTGCCTTTGGGACTGCGAGGCTTTGAGGACGGGAGAGGTGAGTGGAATTCCCA0.333333
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGCGTAGGTGGCCCGGTAAGTCCGCTCTGAAAGTCACAGGCTCAACCTGTGAAAGCGGGTGGATACTGCCGGGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.333333
d__BacteriaTACGAAGGTGGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGTGCGGTAAGCCCTCCGGGAAAGCTTCAGGCTTAACCTGAAAAGGTCGGGGGGGACTGCCGCGCTAGAGGACGGGAGAGGAGCGCGGAATTCCCGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Solirubrobacteraceae;g__SolirubrobacterTACGTAGGGGGCTAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCCCGGTAAGTCCGCTGTGAAAGTCGGGGGCTCAACCCTCGGATGCCGGTGGATACTGTCGGGCTAGAGTGCGGAAGAGGCGAGTGGAATTCCTGG0.333333
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAATTGCCTTTAAGACTGCATCGCTTGAATCCAGGAGAGGTGAGTGGAATTCCGAG0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCCTAGGCGGTTTCTTAAGTCTGCTGTGAAAGACCGGGGCTCAACCCCGGGGTGTCAGCGGAGACTGGGAGACTTGAGTGTCGGAGAGGAGTGCGGAATTCCTGG0.333333
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGTCGGTTATTTAAGTCGGGTGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCGATACTGGATAGCTAGAGTTCGGCAGAGGGAAGCGGAATTTCCGG0.333333
d__BacteriaTACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTTCGGCAAGTCTTCAGTGAAATCTCTGGGCTCAACTCAGAGTCTGCTGGGGAAACTGCCGGGCTTGAGTGTGGGAGAGGAGAGTGGAATTCCTGG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
TACGAGGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGCATATCCAGCCCCAAAAGGGAACAGATATACTAGAGTTTTATGTGAGAGGAATATATTAGTACTATTGGTGTAGAGATGAAATTCTTTGATACTA0.500000
d__BacteriaTACGTAAGAGGCTAGTGTTATTCATAATAAATAGGTTTAAAGGGTACGTAGACGGTAGTAAATGTCCTTGTAAGGACGTTTTGCGACTAGAGTTTTATGTGAGGAGTGTCGTACTTGTGGTGTAGAGATAAAATTTTTTGATACTATAGG0.409091
d__BacteriaTTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGTTTGGTCTCGGACGCTGGGTCTGCTTAATTGCATGTACTTGACGGTCCGAGACTTCCTTCTTGGTGAACGGCCGCCTTCGGGTGGTCCGGAAC0.370370
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACCGGAAATCAAGCCATAGTAGGGACTAATTTCCTAGAGTTTTATATGTTAAGATTGAACCAACTGAGAAGCGATAGAATGCGTATGATACAGTGGGGA0.363636
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTCCAAGTTGGAGGTGAAATCCCCGGGCTTAACCTGGGAACTGCCTCCAAAACTGGGAAGCTCGAGTCCGAGAGAGGTGAGTGGAATTTCCAG0.347826
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__RoseomonasTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTCTGTTAGTCAGGCGTGAAATTCCCGGGCTTAACCTGGGGACTGCGCTTGATACTGCGGAGCTTGAGGGTGGAAGAGGGTCGTGGAATTCCCAG0.285714
d__BacteriaTTCCAGCTCCAGTAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTCGAACTTCGGGCCCGACGGGACGGTCCGCCTTACGGTGTGTACTGTCTTGTTGGGTCTTACCTCTTGGTGAAGCGGCATGCTCTTTACTGGGTGTGTC0.272727
d__Bacteria;p__"Bacteroidetes"TACGGATGACACAAGCGTTATTCGGATTTATTGGGTTTAAAGGGTGTGTAGGCTGTTTATTAAGTCAGTAGTGAAAGCTTACAGCTTAACTGTAAAATTGCTATTGATACTGGTAAGCTTGAGTAAGATTGGAGCATCTGGAATGTATGG0.272727
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCCGTTAAGTCCGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCTGGATACTGACGGGCTTGAGTACAGACGAGGTTGGCGGAATGGACCG0.264706
GACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTATATACAGCCCCGCAAGGGTACTTATATAACTAGAGTTTTATGTGAGAGGTTAATTTTAGTACTATCAGAGTAGGGATGAAATCCTTTGATACT0.260870

Annotations:

common ontology terms
term enrichment score
TermScore
leaf surface0.842105
agave0.470588
guanajuato0.400000
leaf0.313725
citrus unshiu0.307692
exosphere0.307692
campinas0.307692
saccharum0.266667
sugarcane0.266667
orchard0.235294
citrus0.210526
desert0.195122
greenhouse0.190476
agave deserti0.181818
agave salmiana0.181818
agave tequiliana0.181818
minas gerais state0.181818
campos rupestres0.181818
barbacenia macrantha0.181818
LOWER IN leaf surface0.173913
mexico0.166667
brazil0.160000
zhejiang province0.121212
cultivated environment0.117647
LOWER IN leaf0.102564
LOWER IN diaporthe citri0.100000
diaporthe citri0.100000
stem surface0.100000
upper stem0.100000
LOWER IN stem surface0.100000
LOWER IN upper stem0.100000
LOWER IN plant disease0.090909
plant disease0.090909
stem0.080000
LOWER IN stem0.080000
state of california0.063492
LOWER IN soil0.016807
soil0.016807
china0.010554
control0.009615
LOWER IN control0.009615
Fraction of dbbact annotations with this term covered by the query
TermScore
leaf surface0.800000
citrus unshiu0.500000
LOWER IN diaporthe citri0.500000
diaporthe citri0.500000
guanajuato0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
agave tequiliana0.500000
exosphere0.500000
campinas0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
stem surface0.500000
upper stem0.500000
LOWER IN stem surface0.500000
LOWER IN upper stem0.500000
LOWER IN leaf surface0.400000
saccharum0.333333
sugarcane0.333333
orchard0.250000
LOWER IN plant disease0.250000
plant disease0.250000
citrus0.200000
leaf0.190476
greenhouse0.166667
stem0.142857
LOWER IN stem0.142857
desert0.125000
cultivated environment0.125000
mexico0.111111
brazil0.105263
LOWER IN leaf0.095238
zhejiang province0.083333
state of california0.037037
LOWER IN soil0.009901
soil0.009901
china0.005405
control0.005263
LOWER IN control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
leaf surface0.888889
leaf0.888889
desert0.444444
agave0.444444
mexico0.333333
guanajuato0.333333
brazil0.333333
citrus unshiu0.222222
china0.222222
citrus0.222222
zhejiang province0.222222
orchard0.222222
state of california0.222222
exosphere0.222222
saccharum0.222222
sugarcane0.222222
campinas0.222222
greenhouse0.222222
LOWER IN leaf0.111111
LOWER IN leaf surface0.111111
agave deserti0.111111
agave salmiana0.111111
agave tequiliana0.111111
cultivated environment0.111111
minas gerais state0.111111
campos rupestres0.111111
barbacenia macrantha0.111111
LOWER IN diaporthe citri0.055556
LOWER IN plant disease0.055556
control0.055556
LOWER IN control0.055556
plant disease0.055556
diaporthe citri0.055556
LOWER IN soil0.055556
soil0.055556
stem surface0.055556
upper stem0.055556
stem0.055556
LOWER IN stem surface0.055556
LOWER IN upper stem0.055556
LOWER IN stem0.055556
Exp. ID User ID Description Date Region Flag Sequences
894amnon high in control compared to diaporthe citri plant disease in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
360amnondominant agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 6
360amnondominant agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 10
360amnondominant agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 14
548amnonhigh freq. in leaf surface of barbacenia macrantha (dominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 16
894amnondominant citrus unshiu, china, leaf surface, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 18
615amnondominant exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 19
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
894amnoncommon leaf surface, citrus unshiu, china, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 172
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108

Problems / suggestions? Please email info AT dbbact DOT org